Incidental Mutation 'R4990:Triobp'
ID 386163
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 042584-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4990 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78851205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 453 (A453D)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: A453D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: A453D

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: A453D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: A453D

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
AA Change: A453D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,334,098 (GRCm39) I1135V possibly damaging Het
Abca14 G A 7: 119,911,388 (GRCm39) R1324K probably benign Het
Amer3 A C 1: 34,627,822 (GRCm39) D687A probably benign Het
Aplnr G A 2: 84,967,721 (GRCm39) V249M probably damaging Het
Atg16l1 A G 1: 87,717,091 (GRCm39) K471R probably benign Het
Cacna1b A G 2: 24,568,886 (GRCm39) probably null Het
Catspere2 A C 1: 177,925,987 (GRCm39) I218L probably benign Het
Ccdc152 A G 15: 3,330,639 (GRCm39) I12T probably benign Het
Cds1 A G 5: 101,946,245 (GRCm39) Y148C probably damaging Het
Cenpe T A 3: 134,962,401 (GRCm39) L1989Q probably damaging Het
Cep295 T C 9: 15,243,434 (GRCm39) Q1674R probably damaging Het
D930020B18Rik C G 10: 121,490,666 (GRCm39) P89A probably damaging Het
D930020B18Rik C T 10: 121,490,667 (GRCm39) P89L probably damaging Het
Dock2 T C 11: 34,586,078 (GRCm39) M535V probably damaging Het
Dscam A G 16: 96,626,715 (GRCm39) V398A probably benign Het
Elmo1 T C 13: 20,526,689 (GRCm39) F413S probably damaging Het
Emb T A 13: 117,401,046 (GRCm39) N198K probably damaging Het
Eno3 A G 11: 70,549,473 (GRCm39) D98G probably damaging Het
Fbp1 C T 13: 63,012,888 (GRCm39) V102I probably benign Het
Fbxw18 T C 9: 109,517,461 (GRCm39) E414G probably damaging Het
Grem2 A G 1: 174,664,379 (GRCm39) C157R probably damaging Het
Hnrnpr G A 4: 136,063,609 (GRCm39) V239I probably damaging Het
Hnrnpr A G 4: 136,056,690 (GRCm39) E230G probably damaging Het
Ipo11 A T 13: 106,997,395 (GRCm39) I688K probably benign Het
Irx4 G T 13: 73,413,626 (GRCm39) R32L probably benign Het
Kcnh7 T C 2: 62,564,632 (GRCm39) N876D probably benign Het
Klk1b26 T A 7: 43,665,673 (GRCm39) probably null Het
Lrp2 G T 2: 69,311,732 (GRCm39) T2582K probably benign Het
Lrriq1 A G 10: 103,036,420 (GRCm39) I911T probably damaging Het
Megf6 A G 4: 154,351,683 (GRCm39) E1132G possibly damaging Het
Mesp1 A G 7: 79,442,669 (GRCm39) Y203H probably damaging Het
Ms4a4a T C 19: 11,356,201 (GRCm39) S29P probably benign Het
Nbeal2 A C 9: 110,463,871 (GRCm39) C1174G probably benign Het
Neb C T 2: 52,145,558 (GRCm39) V2989I probably benign Het
Nkx2-1 T C 12: 56,581,724 (GRCm39) Y41C possibly damaging Het
Nrxn3 T A 12: 89,227,244 (GRCm39) I293N probably damaging Het
Nt5e A G 9: 88,237,646 (GRCm39) N192S probably benign Het
Ntng1 A T 3: 110,042,577 (GRCm39) probably null Het
Or13a17 G A 7: 140,271,360 (GRCm39) E181K probably damaging Het
Or3a1d A G 11: 74,238,023 (GRCm39) I129T probably damaging Het
Or4c110 A T 2: 88,831,816 (GRCm39) I272K probably damaging Het
Or4c15b A T 2: 89,113,671 (GRCm39) probably null Het
Panx1 A G 9: 14,921,513 (GRCm39) Y121H probably damaging Het
Pcsk4 A G 10: 80,161,215 (GRCm39) I233T possibly damaging Het
Pgm3 T A 9: 86,440,465 (GRCm39) I409F probably damaging Het
Plg T C 17: 12,630,397 (GRCm39) Y645H probably benign Het
Pon3 T C 6: 5,221,619 (GRCm39) H337R probably benign Het
Rasa2 A G 9: 96,474,042 (GRCm39) I162T probably benign Het
Ror1 A G 4: 100,299,161 (GRCm39) I845V probably benign Het
Rpl4 T C 9: 64,082,167 (GRCm39) V22A probably benign Het
Ryr3 T C 2: 112,740,318 (GRCm39) N531S probably damaging Het
Ryr3 G T 2: 112,466,122 (GRCm39) Q4746K probably damaging Het
Sbno1 A T 5: 124,538,228 (GRCm39) F571I probably damaging Het
Scarf1 T C 11: 75,416,841 (GRCm39) V761A probably benign Het
Sec22b T G 3: 97,828,427 (GRCm39) probably null Het
Slc45a2 A G 15: 11,001,236 (GRCm39) M112V probably benign Het
Snai3 G A 8: 123,183,071 (GRCm39) T158M possibly damaging Het
Spata31d1a T C 13: 59,850,965 (GRCm39) N388D probably benign Het
Speer1e A T 5: 11,236,381 (GRCm39) E138V probably damaging Het
Sv2b T C 7: 74,767,470 (GRCm39) N642S possibly damaging Het
Svil T A 18: 5,056,810 (GRCm39) I561K probably benign Het
Trappc11 A T 8: 47,943,930 (GRCm39) D1127E probably benign Het
Tubd1 T C 11: 86,448,665 (GRCm39) L295P probably damaging Het
Ulk4 C T 9: 121,021,852 (GRCm39) V620I probably benign Het
Vmn2r39 A G 7: 9,026,675 (GRCm39) I442T probably benign Het
Wwc1 T C 11: 35,767,393 (GRCm39) T413A probably benign Het
Zfp131 A C 13: 120,244,449 (GRCm39) V77G probably damaging Het
Zfyve26 T C 12: 79,334,607 (GRCm39) D137G probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTAGGACTCCCTGTAC -3'
(R):5'- TCCCATTTGCTGCAGGAAG -3'

Sequencing Primer
(F):5'- TAGGACTCCCTGTACCCAGAG -3'
(R):5'- CTGCAGGAAGCTGTAGTCTTATC -3'
Posted On 2016-05-10