Incidental Mutation 'R4991:Tpx2'
ID386176
Institutional Source Beutler Lab
Gene Symbol Tpx2
Ensembl Gene ENSMUSG00000027469
Gene NameTPX2, microtubule-associated
SynonymsDIL2, p100, REPP86
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152847964-152895321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152869724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 60 (S60P)
Ref Sequence ENSEMBL: ENSMUSP00000136457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028969] [ENSMUST00000109816] [ENSMUST00000164120] [ENSMUST00000178997]
Predicted Effect probably benign
Transcript: ENSMUST00000028969
AA Change: S60P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028969
Gene: ENSMUSG00000027469
AA Change: S60P

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109816
AA Change: S60P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105441
Gene: ENSMUSG00000027469
AA Change: S60P

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144848
Predicted Effect probably benign
Transcript: ENSMUST00000164120
AA Change: S60P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128888
Gene: ENSMUSG00000027469
AA Change: S60P

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175928
Predicted Effect probably benign
Transcript: ENSMUST00000178997
AA Change: S60P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136457
Gene: ENSMUSG00000027469
AA Change: S60P

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic arrest at the morula stage, embryonic lethality and tetraploidy of cultured E1.5 embryos. Mice heterozygous for the gene trap allele exhibit aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Tpx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Tpx2 APN 2 152893591 missense probably damaging 1.00
IGL01810:Tpx2 APN 2 152884235 missense probably damaging 1.00
IGL01951:Tpx2 APN 2 152884176 missense probably benign 0.01
IGL02184:Tpx2 APN 2 152882320 nonsense probably null
IGL02422:Tpx2 APN 2 152873144 missense probably benign 0.00
IGL02441:Tpx2 APN 2 152882287 missense possibly damaging 0.88
reddened UTSW 2 152869724 missense probably benign 0.00
Shamed UTSW 2 152873104 missense probably benign
R0063:Tpx2 UTSW 2 152880123 missense probably damaging 0.99
R0076:Tpx2 UTSW 2 152893683 missense probably damaging 1.00
R0271:Tpx2 UTSW 2 152867367 splice site probably benign
R0311:Tpx2 UTSW 2 152890492 missense probably damaging 0.98
R0617:Tpx2 UTSW 2 152873138 missense probably benign 0.01
R1871:Tpx2 UTSW 2 152893603 missense probably damaging 1.00
R1882:Tpx2 UTSW 2 152869691 missense probably benign
R1990:Tpx2 UTSW 2 152890624 missense probably benign
R1991:Tpx2 UTSW 2 152890624 missense probably benign
R1992:Tpx2 UTSW 2 152890624 missense probably benign
R4686:Tpx2 UTSW 2 152889183 missense possibly damaging 0.62
R4712:Tpx2 UTSW 2 152885038 missense probably damaging 1.00
R4792:Tpx2 UTSW 2 152885096 missense probably damaging 0.98
R4873:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4875:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R5178:Tpx2 UTSW 2 152875549 missense probably benign 0.01
R5757:Tpx2 UTSW 2 152885231 splice site probably null
R6158:Tpx2 UTSW 2 152873104 missense probably benign
R6225:Tpx2 UTSW 2 152876628 missense probably benign
R6539:Tpx2 UTSW 2 152876598 nonsense probably null
R6633:Tpx2 UTSW 2 152867354 missense probably damaging 1.00
R7358:Tpx2 UTSW 2 152876630 missense probably benign
R7741:Tpx2 UTSW 2 152867343 missense possibly damaging 0.84
X0023:Tpx2 UTSW 2 152885028 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTCCTCTCTGTAGGATGCTGG -3'
(R):5'- TGAATTCAAACACGTCGCTAAC -3'

Sequencing Primer
(F):5'- TCCTGATGTGTAGTGAATGCAC -3'
(R):5'- TAACAAACCACAATTCCAGTCTCTG -3'
Posted On2016-05-10