Incidental Mutation 'R4991:Nmnat1'
ID386181
Institutional Source Beutler Lab
Gene Symbol Nmnat1
Ensembl Gene ENSMUSG00000028992
Gene Namenicotinamide nucleotide adenylyltransferase 1
Synonymsnmnat, 5730441G13Rik, nicotinamide mononucleotide adenylyl transferase, D4Cole1e, 2610529L11Rik
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149467572-149485202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149469127 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 176 (T176M)
Ref Sequence ENSEMBL: ENSMUSP00000101318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030845] [ENSMUST00000105693] [ENSMUST00000119921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030845
AA Change: T176M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030845
Gene: ENSMUSG00000028992
AA Change: T176M

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 230 2.5e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105693
AA Change: T176M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101318
Gene: ENSMUSG00000028992
AA Change: T176M

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 230 9.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119921
SMART Domains Protein: ENSMUSP00000113156
Gene: ENSMUSG00000028992

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 140 9.8e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes a key step in the biosynthesis of nicotinamide adenine dinucleotide (NAD). The encoded enzyme is one of several nicotinamide nucleotide adenylyltransferases, and is specifically localized to the cell nucleus. Activity of this protein leads to the activation of a nuclear deacetylase that functions in the protection of damaged neurons. Mutations in this gene have been associated with Leber congenital amaurosis 9. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes 1, 3, 4, 14, and 15. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Nmnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Nmnat1 APN 4 149469678 missense possibly damaging 0.94
IGL02943:Nmnat1 APN 4 149473288 missense probably damaging 1.00
R0164:Nmnat1 UTSW 4 149469150 missense possibly damaging 0.78
R0164:Nmnat1 UTSW 4 149469150 missense possibly damaging 0.78
R4363:Nmnat1 UTSW 4 149473445 missense probably benign 0.07
R4583:Nmnat1 UTSW 4 149469151 missense possibly damaging 0.55
R4835:Nmnat1 UTSW 4 149473345 missense possibly damaging 0.92
R5073:Nmnat1 UTSW 4 149469138 missense probably benign 0.01
R5850:Nmnat1 UTSW 4 149469667 nonsense probably null
R7249:Nmnat1 UTSW 4 149469642 missense probably null 0.06
R7471:Nmnat1 UTSW 4 149473301 missense probably damaging 1.00
R7602:Nmnat1 UTSW 4 149473351 missense probably benign
R8478:Nmnat1 UTSW 4 149473384 missense possibly damaging 0.67
R8480:Nmnat1 UTSW 4 149473370 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATGTACTCTTGGACCAGGTC -3'
(R):5'- ACCAGATCTACTTCTCTTGCATACG -3'

Sequencing Primer
(F):5'- GGTACCAAGTAGCGGATGC -3'
(R):5'- CATACGTGCGCGGTCACTTTAG -3'
Posted On2016-05-10