Incidental Mutation 'R4991:Otof'
ID386184
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4991 (G1)
Quality Score94
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30394181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 343 (R343W)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: R328W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: R328W

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: R343W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: R343W

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133509
AA Change: R343W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: R343W

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
R8002:Otof UTSW 5 30380610 missense probably benign 0.10
R8032:Otof UTSW 5 30461798 start codon destroyed probably benign 0.07
Z1176:Otof UTSW 5 30371586 missense probably damaging 0.98
Z1177:Otof UTSW 5 30376297 missense probably damaging 1.00
Z1177:Otof UTSW 5 30383658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGTTTCACTGCCACTC -3'
(R):5'- TTCAGCAAACCAGCCCTGTTC -3'

Sequencing Primer
(F):5'- CCGTGGCTGCCCTACTCATG -3'
(R):5'- AGCCCTGTTCCCTGCCAAATAC -3'
Posted On2016-05-10