Incidental Mutation 'R4991:Nat8f4'
ID386189
Institutional Source Beutler Lab
Gene Symbol Nat8f4
Ensembl Gene ENSMUSG00000068299
Gene NameN-acetyltransferase 8 (GCN5-related) family member 4
Synonyms1700019G17Rik
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85899051-85904884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85901140 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 134 (K134E)
Ref Sequence ENSEMBL: ENSMUSP00000093430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095757] [ENSMUST00000159755]
Predicted Effect probably benign
Transcript: ENSMUST00000095757
AA Change: K134E

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093430
Gene: ENSMUSG00000068299
AA Change: K134E

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Acetyltransf_10 75 192 2.5e-11 PFAM
Pfam:Acetyltransf_8 83 200 2.1e-11 PFAM
Pfam:Acetyltransf_7 104 194 3.3e-14 PFAM
Pfam:Acetyltransf_1 111 193 6.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159755
SMART Domains Protein: ENSMUSP00000124071
Gene: ENSMUSG00000068299

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
Meta Mutation Damage Score 0.1681 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Nat8f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nat8f4 APN 6 85900987 missense probably benign 0.05
IGL03072:Nat8f4 APN 6 85900854 intron probably benign
R1341:Nat8f4 UTSW 6 85901424 missense probably damaging 0.96
R1725:Nat8f4 UTSW 6 85901098 nonsense probably null
R1923:Nat8f4 UTSW 6 85901515 missense probably damaging 1.00
R2258:Nat8f4 UTSW 6 85901225 missense possibly damaging 0.84
R3975:Nat8f4 UTSW 6 85901070 missense possibly damaging 0.62
R4697:Nat8f4 UTSW 6 85901386 missense probably benign 0.01
R4784:Nat8f4 UTSW 6 85901499 missense probably benign 0.03
R4924:Nat8f4 UTSW 6 85901419 missense probably benign 0.03
R6074:Nat8f4 UTSW 6 85901187 missense probably damaging 0.98
R7058:Nat8f4 UTSW 6 85901289 missense possibly damaging 0.73
R7790:Nat8f4 UTSW 6 85900891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTTTTCCGGAAGCCCATG -3'
(R):5'- GGCCACAGTATGCAGCTTTCTC -3'

Sequencing Primer
(F):5'- ATGGCCTGGTAGAGAGCCAC -3'
(R):5'- CCTGCGGCTCCTTATCTGG -3'
Posted On2016-05-10