Incidental Mutation 'R4991:St3gal4'
ID386198
Institutional Source Beutler Lab
Gene Symbol St3gal4
Ensembl Gene ENSMUSG00000032038
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 4
SynonymsST3Gal IV, Siat4c
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35046576-35119268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35053136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000034537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000214526] [ENSMUST00000215089] [ENSMUST00000215463] [ENSMUST00000215638] [ENSMUST00000216557] [ENSMUST00000217149] [ENSMUST00000217542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034537
AA Change: V190A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038
AA Change: V190A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_29 70 332 4.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213526
Predicted Effect probably benign
Transcript: ENSMUST00000214526
Predicted Effect probably benign
Transcript: ENSMUST00000215089
Predicted Effect probably benign
Transcript: ENSMUST00000215463
Predicted Effect probably benign
Transcript: ENSMUST00000215638
Predicted Effect probably benign
Transcript: ENSMUST00000216557
Predicted Effect probably benign
Transcript: ENSMUST00000217149
Predicted Effect probably benign
Transcript: ENSMUST00000217542
Meta Mutation Damage Score 0.2134 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in St3gal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:St3gal4 APN 9 35053069 unclassified probably benign
IGL01448:St3gal4 APN 9 35052331 missense probably benign 0.00
IGL01770:St3gal4 APN 9 35052305 missense possibly damaging 0.73
IGL02862:St3gal4 APN 9 35052247 missense probably benign 0.32
fuji UTSW 9 35053173 nonsense probably null
Granny_smith UTSW 9 35053262 missense probably damaging 1.00
Pomology UTSW 9 35053079 missense possibly damaging 0.67
R0362:St3gal4 UTSW 9 35053173 nonsense probably null
R0863:St3gal4 UTSW 9 35053448 missense probably damaging 1.00
R1457:St3gal4 UTSW 9 35054757 missense possibly damaging 0.66
R1530:St3gal4 UTSW 9 35052296 missense probably benign 0.00
R5452:St3gal4 UTSW 9 35053456 missense probably damaging 1.00
R6277:St3gal4 UTSW 9 35053262 missense probably damaging 1.00
R7564:St3gal4 UTSW 9 35052253 missense probably benign 0.09
R7725:St3gal4 UTSW 9 35053079 missense possibly damaging 0.67
R8080:St3gal4 UTSW 9 35106321 splice site probably null
R8356:St3gal4 UTSW 9 35053142 missense probably damaging 1.00
R8936:St3gal4 UTSW 9 35053427 missense probably damaging 1.00
R8984:St3gal4 UTSW 9 35055648 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAATGCCCTTGTCGAGAAGC -3'
(R):5'- GCCAAAAGGCCTGGTATCTC -3'

Sequencing Primer
(F):5'- GAAAGCCTGGTTCACCATGTC -3'
(R):5'- TGGTATCTCCAGTAATGGATGTTC -3'
Posted On2016-05-10