Mutagenetix > Incidental Mutations

Incidental Mutation 'R4991:Nbeal2'

386200

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

042585-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R4991 (G1)

Quality Score

117

Status

Validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110638767 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 451 (C451Y)

Ref Sequence

ENSEMBL: ENSMUSP00000143265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

probably benign
Transcript: ENSMUST00000130024

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133191
AA Change: C478Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: C478Y

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000149089
AA Change: C444Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724
AA Change: C444Y

Domain	Start	End	E-Value	Type
low complexity region	49	77	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
low complexity region	220	231	N/A	INTRINSIC
low complexity region	480	488	N/A	INTRINSIC
low complexity region	493	508	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153960

Predicted Effect

probably damaging
Transcript: ENSMUST00000167320
AA Change: C478Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: C478Y

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184024

Predicted Effect

probably damaging
Transcript: ENSMUST00000196488
AA Change: C451Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: C451Y

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Meta Mutation Damage Score

0.4160

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.0%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy4	G	T	14: 55,773,465	T665K	probably benign	Het
Adgrf3	C	T	5: 30,199,148	V369M	probably benign	Het
Als2	T	C	1: 59,207,768	K571E	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Asb14	T	C	14: 26,915,058	S586P	probably damaging	Het
Chmp4b	A	G	2: 154,692,625	E187G	probably benign	Het
Cox6b2	T	C	7: 4,752,161	D38G	probably damaging	Het
Cpm	G	A	10: 117,668,103	C138Y	probably damaging	Het
Csmd3	G	T	15: 48,001,478	P785Q	probably damaging	Het
Cstf1	A	G	2: 172,377,800	Y277C	probably damaging	Het
Cstf2t	T	A	19: 31,084,583	N506K	probably damaging	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Ebf2	A	T	14: 67,389,657	T265S	possibly damaging	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Gm13212	C	A	4: 145,622,334	Q114K	probably benign	Het
Gm14548	T	G	7: 3,895,572	Q292H	probably benign	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm19684	A	G	17: 36,127,472		probably benign	Het
Gm29106	T	C	1: 118,178,391	M37T	probably benign	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hdac5	T	A	11: 102,205,624	E252D	probably damaging	Het
Ifitm3	A	T	7: 141,010,459	F63I	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Itgb1bp1	C	T	12: 21,274,848	G69D	probably damaging	Het
Kcnh3	A	G	15: 99,232,756	D418G	probably benign	Het
Kif1a	T	C	1: 93,078,808	T46A	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lca5l	T	C	16: 96,159,732	E510G	possibly damaging	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Mios	T	G	6: 8,215,847	S348A	probably benign	Het
Mog	T	C	17: 37,017,489		probably null	Het
Mtmr7	A	G	8: 40,554,345	S516P	probably damaging	Het
Nat8f4	T	C	6: 85,901,140	K134E	probably benign	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nmnat1	G	A	4: 149,469,127	T176M	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Olfr1031	A	G	2: 85,992,287	M157V	probably damaging	Het
Olfr1447	T	G	19: 12,901,451	T110P	probably damaging	Het
Olfr313	T	C	11: 58,817,718	S237P	probably damaging	Het
Osgin1	A	G	8: 119,445,289	E274G	probably damaging	Het
Otof	G	A	5: 30,394,181	R343W	probably damaging	Het
Pcdha9	A	T	18: 36,998,345	I156F	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Samd4	A	T	14: 47,074,010	S262C	probably damaging	Het
Snap91	T	C	9: 86,790,154		probably null	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
St3gal4	A	G	9: 35,053,136	V190A	possibly damaging	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Tmem201	A	T	4: 149,728,155	Y235N	possibly damaging	Het
Tpx2	T	C	2: 152,869,724	S60P	probably benign	Het
Trpa1	T	C	1: 14,910,746	Y144C	probably benign	Het
U90926	G	A	5: 92,210,020	P91S	probably benign	Het
Utp20	G	T	10: 88,746,934	H2780Q	probably benign	Het
Vmn1r215	T	G	13: 23,076,527	F246V	probably damaging	Het
Vmn2r72	A	G	7: 85,751,130	L237S	probably damaging	Het
Washc5	A	G	15: 59,344,080	S817P	probably damaging	Het
Zbtb24	A	G	10: 41,456,618		probably null	Het
Zfp212	G	A	6: 47,926,862	R127H	probably damaging	Het
Zfp740	G	T	15: 102,208,279		probably null	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
Antonym	UTSW	9	110630252	missense	probably damaging	1.00
dog	UTSW	9	110635341	missense	possibly damaging	0.89
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	splice site	probably null
Schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	splice site	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
R7902:Nbeal2	UTSW	9	110637547	missense	probably benign
R7923:Nbeal2	UTSW	9	110631446	nonsense	probably null
R8018:Nbeal2	UTSW	9	110629157	unclassified	probably benign
R8190:Nbeal2	UTSW	9	110626090	missense	probably benign	0.04
R8297:Nbeal2	UTSW	9	110635341	missense	possibly damaging	0.89
R8404:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8502:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51
Z1176:Nbeal2	UTSW	9	110625816	missense	probably benign	0.01
Z1176:Nbeal2	UTSW	9	110638835	missense	probably benign
Z1177:Nbeal2	UTSW	9	110629854	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGCGAGCCTTCTGAGATTC -3'
(R):5'- ACCGGGATTGTCACATTCTTTC -3'

Sequencing Primer
(F):5'- GAGATTCATTTCCACTTGACTCTGAG -3'
(R):5'- TTTCCACCTACAGGCTGTGGAG -3'

Posted On

2016-05-10