Incidental Mutation 'R4991:Cpm'
ID386205
Institutional Source Beutler Lab
Gene Symbol Cpm
Ensembl Gene ENSMUSG00000020183
Gene Namecarboxypeptidase M
Synonyms
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4991 (G1)
Quality Score198
Status Validated
Chromosome10
Chromosomal Location117629500-117687352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117668103 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 138 (C138Y)
Ref Sequence ENSEMBL: ENSMUSP00000020399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020399]
Predicted Effect probably damaging
Transcript: ENSMUST00000020399
AA Change: C138Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020399
Gene: ENSMUSG00000020183
AA Change: C138Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Zn_pept 22 406 2.03e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123374
Meta Mutation Damage Score 0.5112 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound arginine/lysine carboxypeptidase. Its expression is associated with monocyte to macrophage differentiation. This encoded protein contains hydrophobic regions at the amino and carboxy termini and has 6 potential asparagine-linked glycosylation sites. The active site residues of carboxypeptidases A and B are conserved in this protein. Three alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Cpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Cpm APN 10 117676066 missense probably damaging 1.00
IGL01400:Cpm APN 10 117659775 missense probably benign 0.25
IGL02655:Cpm APN 10 117683281 missense probably benign 0.01
IGL02724:Cpm APN 10 117629851 missense probably damaging 1.00
IGL03144:Cpm APN 10 117683414 missense probably benign 0.03
R0898:Cpm UTSW 10 117676106 splice site probably benign
R2179:Cpm UTSW 10 117683361 missense probably benign 0.24
R2213:Cpm UTSW 10 117659839 missense probably damaging 1.00
R4622:Cpm UTSW 10 117670297 missense possibly damaging 0.91
R4623:Cpm UTSW 10 117670297 missense possibly damaging 0.91
R4658:Cpm UTSW 10 117668051 missense probably benign 0.43
R4714:Cpm UTSW 10 117675985 missense probably damaging 0.97
R5430:Cpm UTSW 10 117676081 missense possibly damaging 0.92
R5765:Cpm UTSW 10 117671733 missense probably benign 0.09
R6757:Cpm UTSW 10 117671638 missense probably damaging 1.00
R6803:Cpm UTSW 10 117676097 splice site probably null
R7509:Cpm UTSW 10 117659840 missense probably damaging 1.00
R7761:Cpm UTSW 10 117683435 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTTTTGCACGCAGACTGTAG -3'
(R):5'- CCGTACCTGAGCTGAGAAAG -3'

Sequencing Primer
(F):5'- TAGGGCGAGAACTGCTGCTC -3'
(R):5'- TGAGAAAGCACCCTCGGG -3'
Posted On2016-05-10