Incidental Mutation 'R4991:Hdac5'
ID386207
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
SynonymsmHDA1
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102205624 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 252 (E252D)
Ref Sequence ENSEMBL: ENSMUSP00000102770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000131254] [ENSMUST00000156337]
Predicted Effect probably damaging
Transcript: ENSMUST00000008999
AA Change: E270D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: E270D

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107150
AA Change: E251D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: E251D

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107151
AA Change: E252D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: E252D

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107152
AA Change: E252D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: E252D

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131254
SMART Domains Protein: ENSMUSP00000118108
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:HDAC4_Gln 57 146 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150683
Predicted Effect probably benign
Transcript: ENSMUST00000156337
SMART Domains Protein: ENSMUSP00000116646
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:HDAC4_Gln 25 114 2e-38 PFAM
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
R8140:Hdac5 UTSW 11 102197355 missense probably damaging 1.00
R8151:Hdac5 UTSW 11 102206468 missense probably benign 0.00
R8684:Hdac5 UTSW 11 102205321 missense probably benign 0.01
R8719:Hdac5 UTSW 11 102207137 missense probably benign 0.18
R8751:Hdac5 UTSW 11 102218454 missense probably benign 0.19
R8893:Hdac5 UTSW 11 102206686 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCTTCACCATTAGGACAGGAG -3'
(R):5'- TACAAATTGCCTTTGCTTGGG -3'

Sequencing Primer
(F):5'- ACAGGAGAGGTGATCTTACCCC -3'
(R):5'- ATGACAGCCGTGATGACTTTC -3'
Posted On2016-05-10