Incidental Mutation 'R4991:Itgb1bp1'
ID386208
Institutional Source Beutler Lab
Gene Symbol Itgb1bp1
Ensembl Gene ENSMUSG00000062352
Gene Nameintegrin beta 1 binding protein 1
Synonymsbodenin
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21240825-21286284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21274848 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 69 (G69D)
Ref Sequence ENSEMBL: ENSMUSP00000156312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064595] [ENSMUST00000076260] [ENSMUST00000090834] [ENSMUST00000101562] [ENSMUST00000172834] [ENSMUST00000173729] [ENSMUST00000232072]
Predicted Effect probably benign
Transcript: ENSMUST00000064595
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076260
AA Change: G69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075609
Gene: ENSMUSG00000062352
AA Change: G69D

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090834
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101562
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172834
AA Change: G69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134508
Gene: ENSMUSG00000062352
AA Change: G69D

DomainStartEndE-ValueType
Pfam:ICAP-1_inte_bdg 1 183 5.1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173614
Predicted Effect probably benign
Transcript: ENSMUST00000173688
SMART Domains Protein: ENSMUSP00000133557
Gene: ENSMUSG00000062352

DomainStartEndE-ValueType
Pfam:ICAP-1_inte_bdg 1 79 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173729
AA Change: G69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134627
Gene: ENSMUSG00000062352
AA Change: G69D

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232072
AA Change: G69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9174 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, reduced weight and length, reduced ossification, and skull and skeleton abnormalities. Mice homozygous for a gene trap mutation are viable and do not exhibit any obvious abnormalites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Itgb1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Itgb1bp1 APN 12 21279468 missense unknown
IGL02812:Itgb1bp1 APN 12 21270878 splice site probably benign
IGL02820:Itgb1bp1 APN 12 21276853 missense possibly damaging 0.94
IGL03046:Itgb1bp1 UTSW 12 21279435 missense unknown
R0491:Itgb1bp1 UTSW 12 21276895 unclassified probably benign
R0511:Itgb1bp1 UTSW 12 21271435 missense probably damaging 1.00
R2158:Itgb1bp1 UTSW 12 21276859 missense probably damaging 1.00
R4476:Itgb1bp1 UTSW 12 21270956 missense probably benign 0.01
R4596:Itgb1bp1 UTSW 12 21272134 missense probably damaging 1.00
R7128:Itgb1bp1 UTSW 12 21272088 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTGCAGTGAGCCCAAGAGAAAC -3'
(R):5'- ACATAGCTATTCTAATGACAGTCTTGC -3'

Sequencing Primer
(F):5'- CAGTGAGCCCAAGAGAAACATTTTTC -3'
(R):5'- ACAAGGACTGAGAATGTTC -3'
Posted On2016-05-10