Incidental Mutation 'R4991:Nkx2-1'
ID386209
Institutional Source Beutler Lab
Gene Symbol Nkx2-1
Ensembl Gene ENSMUSG00000001496
Gene NameNK2 homeobox 1
Synonymsthyroid-specific enhancer-binding protein, Titf1, tinman, thyroid transcription factor-1, T/EBP, Ttf-1
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4991 (G1)
Quality Score120
Status Validated
Chromosome12
Chromosomal Location56531958-56536908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56534939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 41 (Y41C)
Ref Sequence ENSEMBL: ENSMUSP00000136103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001536] [ENSMUST00000178477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001536
AA Change: Y41C

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001536
Gene: ENSMUSG00000001496
AA Change: Y41C

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178477
AA Change: Y41C

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136103
Gene: ENSMUSG00000001496
AA Change: Y41C

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183231
Meta Mutation Damage Score 0.2152 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted mutation have profoundly abnormal lungs and ventral forebrain defects, lack thyroids, pituitary gland, and tracheoesophageal septation, and die at birth from respiratory failure. Carriers show incoordination and high TSH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Nkx2-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0617:Nkx2-1 UTSW 12 56534855 missense possibly damaging 0.75
R1745:Nkx2-1 UTSW 12 56533744 missense probably benign 0.00
R2209:Nkx2-1 UTSW 12 56533508 missense probably benign 0.15
R2230:Nkx2-1 UTSW 12 56533286 nonsense probably null
R4691:Nkx2-1 UTSW 12 56533565 missense probably benign 0.01
R4990:Nkx2-1 UTSW 12 56534939 missense possibly damaging 0.72
R7216:Nkx2-1 UTSW 12 56534802 missense probably damaging 1.00
R7316:Nkx2-1 UTSW 12 56534798 missense probably benign 0.18
RF006:Nkx2-1 UTSW 12 56533547 missense probably damaging 1.00
Z1176:Nkx2-1 UTSW 12 56533684 missense probably benign 0.00
Z1176:Nkx2-1 UTSW 12 56534964 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCCTACACAAGGCTGTTCG -3'
(R):5'- CACCAGAATATTTGGCAAAGGG -3'

Sequencing Primer
(F):5'- TCACTTACTGGCGGGGAAG -3'
(R):5'- GGCTTCGCCTTCCCCCTC -3'
Posted On2016-05-10