Incidental Mutation 'R0426:Kifap3'
ID38621
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 163865552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably benign
Transcript: ENSMUST00000027877
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077642
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGGAAATCATGTGCTGTTAATCC -3'
(R):5'- GCACTCACAAAGGCTCCGATTCTG -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- GCTCCTCATCTAACTGCAGT -3'
Posted On2013-05-23