Incidental Mutation 'R4991:Vmn1r215'
ID386213
Institutional Source Beutler Lab
Gene Symbol Vmn1r215
Ensembl Gene ENSMUSG00000099917
Gene Namevomeronasal 1 receptor 215
SynonymsV1ri2
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23068025-23078006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23076527 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 246 (F246V)
Ref Sequence ENSEMBL: ENSMUSP00000154763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072972] [ENSMUST00000228092]
Predicted Effect probably damaging
Transcript: ENSMUST00000072972
AA Change: F246V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072739
Gene: ENSMUSG00000099917
AA Change: F246V

DomainStartEndE-ValueType
Pfam:V1R 35 298 2.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228092
AA Change: F246V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Vmn1r215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Vmn1r215 APN 13 23076249 missense probably damaging 0.98
IGL02515:Vmn1r215 APN 13 23075820 missense probably benign 0.21
IGL03061:Vmn1r215 APN 13 23075918 missense probably damaging 0.97
PIT4651001:Vmn1r215 UTSW 13 23076360 missense probably damaging 0.97
R0196:Vmn1r215 UTSW 13 23076084 missense probably damaging 1.00
R0816:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R0817:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R0820:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R1104:Vmn1r215 UTSW 13 23076588 missense possibly damaging 0.50
R1733:Vmn1r215 UTSW 13 23076678 missense probably benign 0.43
R1912:Vmn1r215 UTSW 13 23076503 missense possibly damaging 0.94
R2010:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R2510:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2511:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2877:Vmn1r215 UTSW 13 23076561 missense probably benign 0.01
R3429:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R3854:Vmn1r215 UTSW 13 23075888 missense probably benign
R4124:Vmn1r215 UTSW 13 23075993 missense probably benign 0.42
R4235:Vmn1r215 UTSW 13 23075931 missense probably benign 0.31
R4979:Vmn1r215 UTSW 13 23075894 missense probably benign 0.04
R5011:Vmn1r215 UTSW 13 23076551 missense probably damaging 1.00
R5026:Vmn1r215 UTSW 13 23076279 missense probably benign 0.30
R5070:Vmn1r215 UTSW 13 23076496 missense probably benign 0.03
R5589:Vmn1r215 UTSW 13 23076019 missense probably damaging 1.00
R5589:Vmn1r215 UTSW 13 23076020 missense probably damaging 1.00
R5651:Vmn1r215 UTSW 13 23075811 missense possibly damaging 0.93
R5928:Vmn1r215 UTSW 13 23076317 missense possibly damaging 0.50
R6176:Vmn1r215 UTSW 13 23076358 missense probably damaging 1.00
R6228:Vmn1r215 UTSW 13 23076463 missense probably benign 0.19
R7270:Vmn1r215 UTSW 13 23075919 missense possibly damaging 0.77
R7313:Vmn1r215 UTSW 13 23076314 missense probably benign 0.01
R7820:Vmn1r215 UTSW 13 23076545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTATATGCTCCAATCAAGACAC -3'
(R):5'- CTTCTTAGTGGGCATGGAAGAC -3'

Sequencing Primer
(F):5'- AAGTGGATTTTCCTCTCTCTCATGAC -3'
(R):5'- TCTTAGTGGGCATGGAAGACATTAG -3'
Posted On2016-05-10