Incidental Mutation 'R4991:Irx4'
ID386216
Institutional Source Beutler Lab
Gene Symbol Irx4
Ensembl Gene ENSMUSG00000021604
Gene NameIroquois homeobox 4
Synonyms
MMRRC Submission 042585-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R4991 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73260479-73269608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73265507 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 32 (R32L)
Ref Sequence ENSEMBL: ENSMUSP00000134738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022095] [ENSMUST00000176684]
Predicted Effect probably benign
Transcript: ENSMUST00000022095
AA Change: R32L

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022095
Gene: ENSMUSG00000021604
AA Change: R32L

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176684
AA Change: R32L

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134738
Gene: ENSMUSG00000021604
AA Change: R32L

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Meta Mutation Damage Score 0.0889 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.0%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal ventricular gene expression followed by cardiomyopathy with hypertrophy and impaired contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G T 14: 55,773,465 T665K probably benign Het
Adgrf3 C T 5: 30,199,148 V369M probably benign Het
Als2 T C 1: 59,207,768 K571E probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Asb14 T C 14: 26,915,058 S586P probably damaging Het
Chmp4b A G 2: 154,692,625 E187G probably benign Het
Cox6b2 T C 7: 4,752,161 D38G probably damaging Het
Cpm G A 10: 117,668,103 C138Y probably damaging Het
Csmd3 G T 15: 48,001,478 P785Q probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Cstf2t T A 19: 31,084,583 N506K probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Ebf2 A T 14: 67,389,657 T265S possibly damaging Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gm13212 C A 4: 145,622,334 Q114K probably benign Het
Gm14548 T G 7: 3,895,572 Q292H probably benign Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm19684 A G 17: 36,127,472 probably benign Het
Gm29106 T C 1: 118,178,391 M37T probably benign Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hdac5 T A 11: 102,205,624 E252D probably damaging Het
Ifitm3 A T 7: 141,010,459 F63I probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb1bp1 C T 12: 21,274,848 G69D probably damaging Het
Kcnh3 A G 15: 99,232,756 D418G probably benign Het
Kif1a T C 1: 93,078,808 T46A probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lca5l T C 16: 96,159,732 E510G possibly damaging Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Mios T G 6: 8,215,847 S348A probably benign Het
Mog T C 17: 37,017,489 probably null Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Nat8f4 T C 6: 85,901,140 K134E probably benign Het
Nbeal2 C T 9: 110,638,767 C451Y probably damaging Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nmnat1 G A 4: 149,469,127 T176M possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Olfr1031 A G 2: 85,992,287 M157V probably damaging Het
Olfr1447 T G 19: 12,901,451 T110P probably damaging Het
Olfr313 T C 11: 58,817,718 S237P probably damaging Het
Osgin1 A G 8: 119,445,289 E274G probably damaging Het
Otof G A 5: 30,394,181 R343W probably damaging Het
Pcdha9 A T 18: 36,998,345 I156F probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Samd4 A T 14: 47,074,010 S262C probably damaging Het
Snap91 T C 9: 86,790,154 probably null Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
St3gal4 A G 9: 35,053,136 V190A possibly damaging Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Tmem201 A T 4: 149,728,155 Y235N possibly damaging Het
Tpx2 T C 2: 152,869,724 S60P probably benign Het
Trpa1 T C 1: 14,910,746 Y144C probably benign Het
U90926 G A 5: 92,210,020 P91S probably benign Het
Utp20 G T 10: 88,746,934 H2780Q probably benign Het
Vmn1r215 T G 13: 23,076,527 F246V probably damaging Het
Vmn2r72 A G 7: 85,751,130 L237S probably damaging Het
Washc5 A G 15: 59,344,080 S817P probably damaging Het
Zbtb24 A G 10: 41,456,618 probably null Het
Zfp212 G A 6: 47,926,862 R127H probably damaging Het
Zfp740 G T 15: 102,208,279 probably null Het
Other mutations in Irx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Irx4 APN 13 73268691 missense probably benign
IGL00979:Irx4 APN 13 73268222 splice site probably benign
IGL01291:Irx4 APN 13 73267667 missense probably damaging 1.00
IGL02054:Irx4 APN 13 73268828 missense probably damaging 1.00
IGL02631:Irx4 APN 13 73268477 missense probably damaging 1.00
IGL02893:Irx4 APN 13 73268778 missense probably damaging 1.00
IGL03310:Irx4 APN 13 73267731 missense possibly damaging 0.47
ANU05:Irx4 UTSW 13 73267667 missense probably damaging 1.00
R0468:Irx4 UTSW 13 73266720 splice site probably benign
R0502:Irx4 UTSW 13 73266584 splice site probably null
R0503:Irx4 UTSW 13 73266584 splice site probably null
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1710:Irx4 UTSW 13 73267638 missense possibly damaging 0.90
R1733:Irx4 UTSW 13 73266705 missense probably benign 0.00
R2076:Irx4 UTSW 13 73268265 missense probably damaging 1.00
R2092:Irx4 UTSW 13 73265486 missense probably damaging 0.97
R2127:Irx4 UTSW 13 73265476 missense probably benign 0.03
R2199:Irx4 UTSW 13 73265601 missense probably benign 0.16
R4157:Irx4 UTSW 13 73265543 missense probably benign 0.00
R4883:Irx4 UTSW 13 73267631 missense probably damaging 1.00
R4930:Irx4 UTSW 13 73268913 missense probably benign 0.00
R4990:Irx4 UTSW 13 73265507 missense probably benign 0.28
R5119:Irx4 UTSW 13 73268921 missense probably benign
R5399:Irx4 UTSW 13 73265539 missense probably benign 0.01
R5596:Irx4 UTSW 13 73267680 missense probably damaging 1.00
R5956:Irx4 UTSW 13 73267507 nonsense probably null
R6271:Irx4 UTSW 13 73266594 critical splice acceptor site probably null
R6383:Irx4 UTSW 13 73267713 missense possibly damaging 0.92
R6630:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6631:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6632:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6633:Irx4 UTSW 13 73268426 missense probably benign 0.00
R7378:Irx4 UTSW 13 73267553 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GATTTGAAAAGCTGGCTGGAC -3'
(R):5'- TCACGTAGTTGCCATAGCCC -3'

Sequencing Primer
(F):5'- GCCTAAGCGTGGCCAAAG -3'
(R):5'- TAGTTGCCATAGCCCTGCGAG -3'
Posted On2016-05-10