Mutagenetix > Incidental Mutations

Incidental Mutation 'R4991:Csmd3'

386221

Institutional Source

Beutler Lab

Gene Symbol

Csmd3

Ensembl Gene

ENSMUSG00000022311

Gene Name

CUB and Sushi multiple domains 3

Synonyms

4930500N14Rik

MMRRC Submission

042585-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4991 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47580637-48792063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 48001478 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 785 (P785Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100670
AA Change: P889Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: P889Q

Domain	Start	End	E-Value	Type
CUB	65	173	8.79e-30	SMART
CCP	178	235	1.77e-11	SMART
CUB	241	345	2.29e-28	SMART
low complexity region	370	387	N/A	INTRINSIC
CCP	486	543	6.9e-14	SMART
CUB	548	659	9.22e-24	SMART
CCP	664	717	1.29e-13	SMART
CUB	721	829	6.87e-32	SMART
CCP	834	891	5.19e-9	SMART
CUB	895	1003	3.23e-37	SMART
CCP	1010	1063	1.82e-13	SMART
CUB	1067	1177	4.87e-23	SMART
CCP	1182	1237	1.82e-13	SMART
CUB	1241	1349	5.02e-25	SMART
CCP	1354	1410	2.5e-11	SMART
CUB	1414	1523	6.27e-26	SMART
CCP	1528	1584	4.41e-12	SMART
CUB	1588	1696	5.37e-34	SMART
CCP	1701	1758	1.18e-12	SMART
CUB	1762	1870	2.27e-23	SMART
CCP	1878	1935	1.84e-9	SMART
CUB	1939	2047	1.8e-35	SMART
CCP	2052	2107	4.48e-13	SMART
CUB	2111	2219	3.95e-32	SMART
CCP	2224	2279	4.02e-15	SMART
CUB	2283	2390	1.74e-33	SMART
CCP	2395	2452	5.82e-12	SMART
CUB	2457	2567	5.3e-24	SMART
CCP	2569	2627	2.11e-9	SMART
CCP	2632	2689	8.23e-12	SMART
CCP	2694	2754	8.56e-10	SMART
CCP	2759	2812	1.14e-14	SMART
CCP	2817	2870	4.76e-17	SMART
CCP	2875	2928	1.85e-14	SMART
CCP	2933	2990	9.9e-15	SMART
CCP	2995	3048	1.79e-12	SMART
CCP	3056	3109	1.72e-14	SMART
CCP	3114	3168	3.17e-13	SMART
CCP	3173	3228	1.25e-11	SMART
CCP	3233	3286	1.25e-11	SMART
CCP	3291	3344	8.23e-12	SMART
CCP	3352	3406	5.6e-14	SMART
CCP	3411	3466	1.89e-11	SMART
transmembrane domain	3630	3652	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160658
AA Change: P785Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: P785Q

Domain	Start	End	E-Value	Type
CUB	65	173	8.79e-30	SMART
CCP	178	235	1.77e-11	SMART
CUB	241	345	2.29e-28	SMART
CCP	382	439	6.9e-14	SMART
CUB	444	555	9.22e-24	SMART
CCP	560	613	1.29e-13	SMART
CUB	617	725	6.87e-32	SMART
CCP	730	787	5.19e-9	SMART
CUB	791	899	3.23e-37	SMART
CCP	906	959	1.82e-13	SMART
CUB	963	1073	4.87e-23	SMART
CCP	1078	1133	1.82e-13	SMART
CUB	1137	1245	5.02e-25	SMART
CCP	1250	1306	2.5e-11	SMART
CUB	1310	1419	6.27e-26	SMART
CCP	1424	1480	4.41e-12	SMART
CUB	1484	1592	5.37e-34	SMART
CCP	1597	1654	1.18e-12	SMART
CUB	1658	1766	2.27e-23	SMART
CCP	1774	1831	1.84e-9	SMART
CUB	1835	1943	1.8e-35	SMART
CCP	1948	2003	4.48e-13	SMART
CUB	2007	2115	3.95e-32	SMART
CCP	2120	2175	4.02e-15	SMART
CUB	2179	2286	1.74e-33	SMART
CCP	2291	2348	5.82e-12	SMART
CUB	2353	2463	5.3e-24	SMART
CCP	2465	2523	2.11e-9	SMART
CCP	2528	2585	8.23e-12	SMART
CCP	2590	2643	1.14e-14	SMART
CCP	2648	2701	4.76e-17	SMART
CCP	2706	2759	1.85e-14	SMART
CCP	2764	2821	9.9e-15	SMART
CCP	2826	2879	1.79e-12	SMART
CCP	2887	2940	1.72e-14	SMART
CCP	2945	2999	3.17e-13	SMART
CCP	3004	3059	1.25e-11	SMART
CCP	3064	3117	1.25e-11	SMART
CCP	3122	3175	8.23e-12	SMART
CCP	3183	3237	5.6e-14	SMART
CCP	3242	3297	1.89e-11	SMART
transmembrane domain	3461	3483	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000161653
AA Change: P48Q

SMART Domains

Protein: ENSMUSP00000124195
Gene: ENSMUSG00000022311
AA Change: P48Q

Domain	Start	End	E-Value	Type
CCP	1	51	6.59e-1	SMART
CUB	55	163	3.23e-37	SMART
CCP	170	223	1.82e-13	SMART
CUB	227	337	4.87e-23	SMART
CCP	342	397	1.82e-13	SMART
CUB	401	509	5.02e-25	SMART
CCP	514	570	2.5e-11	SMART
CUB	574	683	6.27e-26	SMART
CCP	688	744	4.41e-12	SMART
CUB	748	856	5.37e-34	SMART
CCP	861	918	1.18e-12	SMART
Pfam:CUB	922	964	9.7e-8	PFAM
CCP	968	1025	1.84e-9	SMART
CUB	1029	1137	1.8e-35	SMART
CCP	1142	1197	4.48e-13	SMART
CUB	1201	1309	3.95e-32	SMART
CCP	1314	1369	4.02e-15	SMART
CUB	1373	1480	1.74e-33	SMART
CCP	1485	1542	5.82e-12	SMART
CUB	1547	1657	5.3e-24	SMART
CCP	1659	1717	2.11e-9	SMART
CCP	1722	1779	8.23e-12	SMART
CCP	1784	1844	8.56e-10	SMART
CCP	1849	1902	1.14e-14	SMART
CCP	1907	1960	4.76e-17	SMART
CCP	1965	2018	1.85e-14	SMART
CCP	2023	2080	9.9e-15	SMART
CCP	2085	2138	1.79e-12	SMART
CCP	2146	2199	1.72e-14	SMART
CCP	2204	2258	3.17e-13	SMART
CCP	2263	2318	1.25e-11	SMART
CCP	2323	2376	1.25e-11	SMART
CCP	2381	2434	8.23e-12	SMART
CCP	2442	2496	5.6e-14	SMART
CCP	2501	2556	1.89e-11	SMART
transmembrane domain	2720	2742	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162830
AA Change: P889Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: P889Q

Domain	Start	End	E-Value	Type
CUB	65	173	8.79e-30	SMART
CCP	178	235	1.77e-11	SMART
CUB	241	345	2.29e-28	SMART
low complexity region	370	387	N/A	INTRINSIC
CCP	486	543	6.9e-14	SMART
CUB	548	659	9.22e-24	SMART
CCP	664	717	1.29e-13	SMART
CUB	721	829	6.87e-32	SMART
CCP	834	891	5.19e-9	SMART
CUB	895	1003	3.23e-37	SMART
CCP	1010	1063	1.82e-13	SMART
CUB	1067	1177	4.87e-23	SMART
CCP	1182	1237	1.82e-13	SMART
CUB	1241	1349	5.02e-25	SMART
CCP	1354	1410	2.5e-11	SMART
CUB	1414	1523	6.27e-26	SMART
CCP	1528	1584	4.41e-12	SMART
CUB	1588	1696	5.37e-34	SMART
CCP	1701	1758	1.18e-12	SMART
CUB	1762	1870	2.27e-23	SMART
CCP	1878	1935	1.84e-9	SMART
CUB	1939	2047	1.8e-35	SMART
CCP	2052	2107	4.48e-13	SMART
CUB	2111	2219	3.95e-32	SMART
CCP	2224	2279	4.02e-15	SMART
CUB	2283	2390	1.74e-33	SMART
CCP	2395	2452	5.82e-12	SMART
CUB	2457	2567	5.3e-24	SMART
CCP	2569	2627	2.11e-9	SMART
CCP	2632	2689	8.23e-12	SMART
CCP	2694	2754	8.56e-10	SMART
CCP	2759	2812	1.14e-14	SMART
CCP	2817	2870	4.76e-17	SMART
CCP	2875	2928	1.85e-14	SMART
CCP	2933	2990	9.9e-15	SMART
CCP	2995	3048	1.79e-12	SMART
CCP	3056	3109	1.72e-14	SMART
CCP	3114	3168	3.17e-13	SMART
CCP	3173	3228	1.25e-11	SMART
CCP	3233	3286	1.25e-11	SMART
CCP	3291	3344	8.23e-12	SMART
CCP	3352	3406	5.6e-14	SMART
CCP	3411	3466	1.89e-11	SMART
transmembrane domain	3630	3652	N/A	INTRINSIC

Meta Mutation Damage Score

0.6103

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.0%

Validation Efficiency

95% (73/77)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy4	G	T	14: 55,773,465	T665K	probably benign	Het
Adgrf3	C	T	5: 30,199,148	V369M	probably benign	Het
Als2	T	C	1: 59,207,768	K571E	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Asb14	T	C	14: 26,915,058	S586P	probably damaging	Het
Chmp4b	A	G	2: 154,692,625	E187G	probably benign	Het
Cox6b2	T	C	7: 4,752,161	D38G	probably damaging	Het
Cpm	G	A	10: 117,668,103	C138Y	probably damaging	Het
Cstf1	A	G	2: 172,377,800	Y277C	probably damaging	Het
Cstf2t	T	A	19: 31,084,583	N506K	probably damaging	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Ebf2	A	T	14: 67,389,657	T265S	possibly damaging	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Gm13212	C	A	4: 145,622,334	Q114K	probably benign	Het
Gm14548	T	G	7: 3,895,572	Q292H	probably benign	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm19684	A	G	17: 36,127,472		probably benign	Het
Gm29106	T	C	1: 118,178,391	M37T	probably benign	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hdac5	T	A	11: 102,205,624	E252D	probably damaging	Het
Ifitm3	A	T	7: 141,010,459	F63I	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Itgb1bp1	C	T	12: 21,274,848	G69D	probably damaging	Het
Kcnh3	A	G	15: 99,232,756	D418G	probably benign	Het
Kif1a	T	C	1: 93,078,808	T46A	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lca5l	T	C	16: 96,159,732	E510G	possibly damaging	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Mios	T	G	6: 8,215,847	S348A	probably benign	Het
Mog	T	C	17: 37,017,489		probably null	Het
Mtmr7	A	G	8: 40,554,345	S516P	probably damaging	Het
Nat8f4	T	C	6: 85,901,140	K134E	probably benign	Het
Nbeal2	C	T	9: 110,638,767	C451Y	probably damaging	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nmnat1	G	A	4: 149,469,127	T176M	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Olfr1031	A	G	2: 85,992,287	M157V	probably damaging	Het
Olfr1447	T	G	19: 12,901,451	T110P	probably damaging	Het
Olfr313	T	C	11: 58,817,718	S237P	probably damaging	Het
Osgin1	A	G	8: 119,445,289	E274G	probably damaging	Het
Otof	G	A	5: 30,394,181	R343W	probably damaging	Het
Pcdha9	A	T	18: 36,998,345	I156F	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Samd4	A	T	14: 47,074,010	S262C	probably damaging	Het
Snap91	T	C	9: 86,790,154		probably null	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
St3gal4	A	G	9: 35,053,136	V190A	possibly damaging	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Tmem201	A	T	4: 149,728,155	Y235N	possibly damaging	Het
Tpx2	T	C	2: 152,869,724	S60P	probably benign	Het
Trpa1	T	C	1: 14,910,746	Y144C	probably benign	Het
U90926	G	A	5: 92,210,020	P91S	probably benign	Het
Utp20	G	T	10: 88,746,934	H2780Q	probably benign	Het
Vmn1r215	T	G	13: 23,076,527	F246V	probably damaging	Het
Vmn2r72	A	G	7: 85,751,130	L237S	probably damaging	Het
Washc5	A	G	15: 59,344,080	S817P	probably damaging	Het
Zbtb24	A	G	10: 41,456,618		probably null	Het
Zfp212	G	A	6: 47,926,862	R127H	probably damaging	Het
Zfp740	G	T	15: 102,208,279		probably null	Het

Other mutations in Csmd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Csmd3	APN	15	48287495	missense	possibly damaging	0.61
IGL00591:Csmd3	APN	15	48004883	missense	probably damaging	1.00
IGL00668:Csmd3	APN	15	47913945	missense	probably damaging	1.00
IGL00753:Csmd3	APN	15	47644235	missense	probably damaging	1.00
IGL00773:Csmd3	APN	15	47590719	missense	probably damaging	0.96
IGL00926:Csmd3	APN	15	47710964	missense	possibly damaging	0.87
IGL00942:Csmd3	APN	15	47847106	critical splice donor site	probably null
IGL01080:Csmd3	APN	15	47881403	missense	probably benign	0.12
IGL01314:Csmd3	APN	15	47849755	missense	probably damaging	1.00
IGL01326:Csmd3	APN	15	47849785	missense	probably benign	0.06
IGL01393:Csmd3	APN	15	48457599	missense	possibly damaging	0.88
IGL01432:Csmd3	APN	15	47733499	missense	probably damaging	1.00
IGL01519:Csmd3	APN	15	47596850	missense	probably benign	0.31
IGL01530:Csmd3	APN	15	47838437	missense	possibly damaging	0.95
IGL01530:Csmd3	APN	15	47669617	missense	probably damaging	1.00
IGL01547:Csmd3	APN	15	47883617	missense	probably benign	0.41
IGL01594:Csmd3	APN	15	47629239	missense	probably benign	0.01
IGL01618:Csmd3	APN	15	48011083	missense	probably benign	0.05
IGL01670:Csmd3	APN	15	47611829	missense	probably damaging	1.00
IGL01680:Csmd3	APN	15	47970030	missense	probably damaging	1.00
IGL01734:Csmd3	APN	15	48185304	missense	probably damaging	1.00
IGL01777:Csmd3	APN	15	47698198	missense	probably benign	0.06
IGL01779:Csmd3	APN	15	47857894	missense	probably benign	0.10
IGL01820:Csmd3	APN	15	47607142	nonsense	probably null
IGL01843:Csmd3	APN	15	47658999	splice site	probably benign
IGL01919:Csmd3	APN	15	47675772	missense	possibly damaging	0.62
IGL01986:Csmd3	APN	15	47659195	missense	possibly damaging	0.82
IGL02049:Csmd3	APN	15	48001474	missense	possibly damaging	0.91
IGL02065:Csmd3	APN	15	47666628	missense	probably damaging	1.00
IGL02112:Csmd3	APN	15	48313869	missense	possibly damaging	0.95
IGL02133:Csmd3	APN	15	47857942	missense	possibly damaging	0.86
IGL02203:Csmd3	APN	15	47849677	splice site	probably null
IGL02215:Csmd3	APN	15	47585688	missense	probably damaging	1.00
IGL02234:Csmd3	APN	15	47948116	missense	probably damaging	1.00
IGL02326:Csmd3	APN	15	47755963	splice site	probably benign
IGL02478:Csmd3	APN	15	47838398	splice site	probably benign
IGL02491:Csmd3	APN	15	47914115	splice site	probably benign
IGL02598:Csmd3	APN	15	47669690	missense	probably damaging	0.98
IGL02626:Csmd3	APN	15	47704107	splice site	probably benign
IGL02696:Csmd3	APN	15	47669669	missense	probably benign	0.33
IGL02876:Csmd3	APN	15	47606096	splice site	probably benign
IGL02971:Csmd3	APN	15	47913929	splice site	probably benign
IGL03068:Csmd3	APN	15	47847121	missense	possibly damaging	0.69
IGL03087:Csmd3	APN	15	47977033	missense	probably damaging	1.00
IGL03114:Csmd3	APN	15	47820451	missense	probably damaging	0.99
IGL03146:Csmd3	APN	15	47881477	missense	probably benign	0.25
IGL03193:Csmd3	APN	15	47629230	splice site	probably benign
IGL03274:Csmd3	APN	15	47645504	missense	probably damaging	1.00
R0040:Csmd3	UTSW	15	47633816	missense	probably damaging	1.00
R0071:Csmd3	UTSW	15	47596821	missense	probably benign	0.04
R0071:Csmd3	UTSW	15	47596821	missense	probably benign	0.04
R0119:Csmd3	UTSW	15	47847131	missense	probably benign	0.08
R0124:Csmd3	UTSW	15	47590716	missense	probably damaging	1.00
R0127:Csmd3	UTSW	15	47981930	missense	probably benign	0.45
R0136:Csmd3	UTSW	15	47847131	missense	probably benign	0.08
R0201:Csmd3	UTSW	15	47619729	splice site	probably benign
R0240:Csmd3	UTSW	15	47629239	missense	probably benign	0.05
R0240:Csmd3	UTSW	15	47629239	missense	probably benign	0.05
R0318:Csmd3	UTSW	15	47659153	missense	probably damaging	1.00
R0369:Csmd3	UTSW	15	47970147	missense	probably damaging	1.00
R0391:Csmd3	UTSW	15	47657573	missense	probably damaging	1.00
R0499:Csmd3	UTSW	15	47847131	missense	probably benign	0.08
R0506:Csmd3	UTSW	15	48457511	missense	probably benign	0.00
R0606:Csmd3	UTSW	15	48457662	missense	probably benign
R0639:Csmd3	UTSW	15	47913940	missense	probably damaging	1.00
R0658:Csmd3	UTSW	15	48011147	missense	possibly damaging	0.66
R0673:Csmd3	UTSW	15	47913940	missense	probably damaging	1.00
R0689:Csmd3	UTSW	15	47756025	missense	probably benign	0.19
R0696:Csmd3	UTSW	15	47847173	missense	probably benign	0.01
R0799:Csmd3	UTSW	15	48185384	splice site	probably benign
R0834:Csmd3	UTSW	15	47883677	intron	probably benign
R0894:Csmd3	UTSW	15	47857920	missense	possibly damaging	0.95
R0926:Csmd3	UTSW	15	47977033	missense	probably damaging	1.00
R0943:Csmd3	UTSW	15	47675739	missense	probably damaging	0.99
R0944:Csmd3	UTSW	15	47611831	missense	probably damaging	1.00
R0967:Csmd3	UTSW	15	47857831	missense	probably null	0.89
R0973:Csmd3	UTSW	15	47659089	missense	probably damaging	1.00
R1055:Csmd3	UTSW	15	47881537	missense	probably damaging	1.00
R1066:Csmd3	UTSW	15	47913965	missense	probably damaging	1.00
R1086:Csmd3	UTSW	15	47695755	missense	probably damaging	0.99
R1103:Csmd3	UTSW	15	47948006	missense	probably damaging	1.00
R1136:Csmd3	UTSW	15	47675817	missense	probably damaging	1.00
R1139:Csmd3	UTSW	15	47695836	missense	probably damaging	1.00
R1158:Csmd3	UTSW	15	48292774	splice site	probably null
R1215:Csmd3	UTSW	15	48004831	splice site	probably null
R1233:Csmd3	UTSW	15	48673531	missense	probably damaging	1.00
R1271:Csmd3	UTSW	15	48011059	missense	probably benign	0.11
R1469:Csmd3	UTSW	15	47669202	nonsense	probably null
R1469:Csmd3	UTSW	15	47669202	nonsense	probably null
R1479:Csmd3	UTSW	15	47857886	missense	probably damaging	1.00
R1480:Csmd3	UTSW	15	47731929	missense	possibly damaging	0.90
R1526:Csmd3	UTSW	15	47585632	critical splice donor site	probably null
R1527:Csmd3	UTSW	15	47948087	missense	probably benign	0.08
R1539:Csmd3	UTSW	15	47820398	missense	probably benign	0.24
R1544:Csmd3	UTSW	15	47611898	splice site	probably null
R1548:Csmd3	UTSW	15	47981975	missense	possibly damaging	0.91
R1574:Csmd3	UTSW	15	47695861	splice site	probably null
R1574:Csmd3	UTSW	15	47695861	splice site	probably null
R1619:Csmd3	UTSW	15	47949950	missense	probably damaging	1.00
R1630:Csmd3	UTSW	15	47838522	missense	possibly damaging	0.66
R1665:Csmd3	UTSW	15	47696789	missense	probably damaging	1.00
R1680:Csmd3	UTSW	15	47741170	missense	probably damaging	1.00
R1725:Csmd3	UTSW	15	47596807	missense	probably damaging	1.00
R1743:Csmd3	UTSW	15	48622089	missense	probably damaging	1.00
R1749:Csmd3	UTSW	15	47585660	missense	probably damaging	1.00
R1752:Csmd3	UTSW	15	47660273	missense	probably benign	0.15
R1769:Csmd3	UTSW	15	47704109	splice site	probably benign
R1775:Csmd3	UTSW	15	47899739	missense	probably damaging	0.99
R1795:Csmd3	UTSW	15	47857920	missense	possibly damaging	0.95
R1819:Csmd3	UTSW	15	47753735	missense	possibly damaging	0.56
R1840:Csmd3	UTSW	15	47607164	missense	probably damaging	1.00
R1860:Csmd3	UTSW	15	47659192	missense	probably damaging	1.00
R1861:Csmd3	UTSW	15	47659192	missense	probably damaging	1.00
R1879:Csmd3	UTSW	15	47657519	missense	possibly damaging	0.90
R1958:Csmd3	UTSW	15	48004639	critical splice donor site	probably null
R1965:Csmd3	UTSW	15	47849748	missense	probably benign	0.15
R1970:Csmd3	UTSW	15	48673531	missense	probably damaging	1.00
R2029:Csmd3	UTSW	15	47838579	missense	probably damaging	1.00
R2051:Csmd3	UTSW	15	48621993	critical splice donor site	probably null
R2108:Csmd3	UTSW	15	48004861	missense	possibly damaging	0.81
R2132:Csmd3	UTSW	15	48457503	missense	probably benign	0.06
R2146:Csmd3	UTSW	15	47741236	frame shift	probably null
R2147:Csmd3	UTSW	15	47741236	frame shift	probably null
R2148:Csmd3	UTSW	15	47741236	frame shift	probably null
R2157:Csmd3	UTSW	15	47695787	missense	probably damaging	0.99
R2159:Csmd3	UTSW	15	47741236	frame shift	probably null
R2160:Csmd3	UTSW	15	47741236	frame shift	probably null
R2161:Csmd3	UTSW	15	47741236	frame shift	probably null
R2162:Csmd3	UTSW	15	47741236	frame shift	probably null
R2164:Csmd3	UTSW	15	47741236	frame shift	probably null
R2213:Csmd3	UTSW	15	47820447	missense	possibly damaging	0.92
R2301:Csmd3	UTSW	15	47731998	missense	probably damaging	1.00
R2302:Csmd3	UTSW	15	48314051	missense	probably benign
R2355:Csmd3	UTSW	15	47741236	frame shift	probably null
R2497:Csmd3	UTSW	15	47741236	frame shift	probably null
R2509:Csmd3	UTSW	15	47741236	frame shift	probably null
R2566:Csmd3	UTSW	15	47741236	frame shift	probably null
R2567:Csmd3	UTSW	15	47741236	frame shift	probably null
R2568:Csmd3	UTSW	15	47741236	frame shift	probably null
R2570:Csmd3	UTSW	15	47741236	frame shift	probably null
R2571:Csmd3	UTSW	15	47741236	frame shift	probably null
R2870:Csmd3	UTSW	15	47857924	missense	probably damaging	1.00
R2870:Csmd3	UTSW	15	47857924	missense	probably damaging	1.00
R2907:Csmd3	UTSW	15	48011053	missense	probably damaging	0.99
R3116:Csmd3	UTSW	15	47657599	missense	probably damaging	1.00
R3423:Csmd3	UTSW	15	47847252	missense	probably damaging	0.98
R3425:Csmd3	UTSW	15	47847252	missense	probably damaging	0.98
R3508:Csmd3	UTSW	15	47741236	frame shift	probably null
R3746:Csmd3	UTSW	15	47849766	missense	probably benign	0.04
R3813:Csmd3	UTSW	15	48791813	missense	possibly damaging	0.82
R3832:Csmd3	UTSW	15	47741236	frame shift	probably null
R3959:Csmd3	UTSW	15	47644189	missense	probably benign	0.18
R4042:Csmd3	UTSW	15	47614084	missense	probably damaging	1.00
R4043:Csmd3	UTSW	15	47755966	critical splice donor site	probably null
R4191:Csmd3	UTSW	15	47847271	missense	probably damaging	0.99
R4192:Csmd3	UTSW	15	47847271	missense	probably damaging	0.99
R4419:Csmd3	UTSW	15	47704311	missense	probably damaging	1.00
R4426:Csmd3	UTSW	15	47669185	missense	possibly damaging	0.51
R4434:Csmd3	UTSW	15	47899795	missense	possibly damaging	0.68
R4438:Csmd3	UTSW	15	47899795	missense	possibly damaging	0.68
R4490:Csmd3	UTSW	15	48314033	missense	possibly damaging	0.83
R4562:Csmd3	UTSW	15	47899844	missense	probably benign	0.32
R4604:Csmd3	UTSW	15	48004815	missense	possibly damaging	0.90
R4620:Csmd3	UTSW	15	47585753	missense	probably benign	0.09
R4632:Csmd3	UTSW	15	48011209	missense	probably damaging	0.99
R4679:Csmd3	UTSW	15	48161083	nonsense	probably null
R4696:Csmd3	UTSW	15	47913968	missense	probably benign	0.24
R4718:Csmd3	UTSW	15	47698150	nonsense	probably null
R4723:Csmd3	UTSW	15	47669160	missense	probably benign	0.29
R4801:Csmd3	UTSW	15	47621292	missense	probably damaging	1.00
R4802:Csmd3	UTSW	15	47621292	missense	probably damaging	1.00
R4806:Csmd3	UTSW	15	48314068	missense	probably benign
R4816:Csmd3	UTSW	15	47857934	missense	possibly damaging	0.68
R4935:Csmd3	UTSW	15	48161084	missense	probably damaging	1.00
R4955:Csmd3	UTSW	15	48673518	missense	probably damaging	0.99
R5031:Csmd3	UTSW	15	47659192	missense	probably damaging	1.00
R5034:Csmd3	UTSW	15	47629287	missense	possibly damaging	0.94
R5035:Csmd3	UTSW	15	47590779	missense	probably damaging	1.00
R5120:Csmd3	UTSW	15	48673495	nonsense	probably null
R5224:Csmd3	UTSW	15	47888684	missense	possibly damaging	0.91
R5235:Csmd3	UTSW	15	47629278	missense	probably benign	0.20
R5279:Csmd3	UTSW	15	48791944	splice site	probably null
R5360:Csmd3	UTSW	15	47669203	missense	probably damaging	0.99
R5365:Csmd3	UTSW	15	48004749	missense	possibly damaging	0.68
R5379:Csmd3	UTSW	15	47636450	nonsense	probably null
R5381:Csmd3	UTSW	15	47741215	missense	probably benign	0.21
R5393:Csmd3	UTSW	15	47633703	missense	probably damaging	1.00
R5413:Csmd3	UTSW	15	47838435	missense	probably damaging	1.00
R5549:Csmd3	UTSW	15	48185357	missense	probably damaging	0.98
R5550:Csmd3	UTSW	15	48185357	missense	probably damaging	0.98
R5551:Csmd3	UTSW	15	48314096	missense	probably benign	0.13
R5567:Csmd3	UTSW	15	47645468	missense	possibly damaging	0.92
R5621:Csmd3	UTSW	15	48313978	missense	possibly damaging	0.84
R5668:Csmd3	UTSW	15	47695755	missense	possibly damaging	0.48
R5677:Csmd3	UTSW	15	48622051	missense	probably damaging	0.98
R5701:Csmd3	UTSW	15	47650221	missense	probably damaging	1.00
R5701:Csmd3	UTSW	15	48540333	missense	probably damaging	0.99
R5871:Csmd3	UTSW	15	47888716	missense	probably damaging	0.98
R5872:Csmd3	UTSW	15	47582527	missense	probably damaging	1.00
R5874:Csmd3	UTSW	15	47644270	missense	probably damaging	1.00
R5952:Csmd3	UTSW	15	47733505	missense	probably damaging	0.98
R5956:Csmd3	UTSW	15	48791882	missense	possibly damaging	0.84
R5966:Csmd3	UTSW	15	47849739	missense	probably damaging	0.96
R5969:Csmd3	UTSW	15	47947990	missense	probably damaging	1.00
R5989:Csmd3	UTSW	15	47590764	missense	possibly damaging	0.69
R6017:Csmd3	UTSW	15	48314012	missense	possibly damaging	0.95
R6057:Csmd3	UTSW	15	47755391	missense	probably damaging	1.00
R6127:Csmd3	UTSW	15	47650228	missense	probably damaging	1.00
R6178:Csmd3	UTSW	15	48673458	missense	probably damaging	1.00
R6198:Csmd3	UTSW	15	48313877	missense	probably benign	0.28
R6213:Csmd3	UTSW	15	47629260	missense	probably damaging	1.00
R6256:Csmd3	UTSW	15	47669729	missense	probably damaging	1.00
R6274:Csmd3	UTSW	15	47621437	missense	probably benign
R6327:Csmd3	UTSW	15	47881387	missense	probably damaging	1.00
R6354:Csmd3	UTSW	15	47881489	missense	probably damaging	1.00
R6405:Csmd3	UTSW	15	47820371	missense	probably damaging	0.99
R6410:Csmd3	UTSW	15	48673407	missense	probably damaging	1.00
R6416:Csmd3	UTSW	15	48673560	missense	probably damaging	1.00
R6463:Csmd3	UTSW	15	47676479	missense	probably damaging	1.00
R6536:Csmd3	UTSW	15	47838467	missense	probably damaging	1.00
R6625:Csmd3	UTSW	15	47607075	missense	probably benign	0.02
R6695:Csmd3	UTSW	15	47857834	missense	probably damaging	0.99
R6895:Csmd3	UTSW	15	47666514	splice site	probably null
R6906:Csmd3	UTSW	15	47847173	missense	probably benign	0.01
R6914:Csmd3	UTSW	15	48011138	missense	possibly damaging	0.53
R6920:Csmd3	UTSW	15	47644205	missense	probably damaging	1.00
R7024:Csmd3	UTSW	15	47710991	missense	probably damaging	1.00
R7178:Csmd3	UTSW	15	47590774	missense
R7192:Csmd3	UTSW	15	47704237	missense
R7220:Csmd3	UTSW	15	48457598	missense	probably damaging	0.99
R7362:Csmd3	UTSW	15	47755992	missense	possibly damaging	0.65
R7380:Csmd3	UTSW	15	47586965	missense
R7397:Csmd3	UTSW	15	47695734	missense
R7467:Csmd3	UTSW	15	47629244	missense
R7585:Csmd3	UTSW	15	48622075	missense	possibly damaging	0.76
R7623:Csmd3	UTSW	15	47949938	missense
R7649:Csmd3	UTSW	15	47669143	missense
R7691:Csmd3	UTSW	15	47741173	missense
R7695:Csmd3	UTSW	15	47820381	missense
R7759:Csmd3	UTSW	15	47698173	missense
R7817:Csmd3	UTSW	15	47857960	missense	probably damaging	0.99
R8052:Csmd3	UTSW	15	47706387	missense
R8089:Csmd3	UTSW	15	47669207	missense
R8110:Csmd3	UTSW	15	47644270	missense	probably damaging	1.00
R8152:Csmd3	UTSW	15	47669464	splice site	probably null
R8323:Csmd3	UTSW	15	47698151	missense
R8341:Csmd3	UTSW	15	47698151	missense
R8353:Csmd3	UTSW	15	47949953	missense	probably damaging	1.00
R8364:Csmd3	UTSW	15	48673441	missense	probably damaging	1.00
R8405:Csmd3	UTSW	15	47755983	missense	probably damaging	1.00
R8412:Csmd3	UTSW	15	47636398	missense
R8436:Csmd3	UTSW	15	48004822	missense	probably damaging	0.97
R8516:Csmd3	UTSW	15	47629365	nonsense	probably null
R8553:Csmd3	UTSW	15	47621328	missense	possibly damaging	0.52
R8554:Csmd3	UTSW	15	47644142	missense	probably benign	0.32
U24488:Csmd3	UTSW	15	47710399	missense	probably damaging	1.00
V8831:Csmd3	UTSW	15	48457696	missense	probably damaging	0.96
X0021:Csmd3	UTSW	15	47970093	nonsense	probably null
Z1088:Csmd3	UTSW	15	47636393	missense	probably damaging	1.00
Z1088:Csmd3	UTSW	15	47847281	missense	probably damaging	0.98
Z1177:Csmd3	UTSW	15	47675734	missense
Z1177:Csmd3	UTSW	15	47733417	missense

Predicted Primers

PCR Primer
(F):5'- GACTCAAAGAGGGATCTTAAAAGTC -3'
(R):5'- GCATTTGGACATAATGAATGCCC -3'

Sequencing Primer
(F):5'- GAAGCTCACATCAGGTACT -3'
(R):5'- GGACATAATGAATGCCCAGATCCTG -3'

Posted On

2016-05-10