Incidental Mutation 'R0426:Ppox'
ID 38624
Institutional Source Beutler Lab
Gene Symbol Ppox
Ensembl Gene ENSMUSG00000062729
Gene Name protoporphyrinogen oxidase
Synonyms
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R0426 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171275990-171281186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 171277749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 321 (Y321C)
Ref Sequence ENSEMBL: ENSMUSP00000141835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000192956] [ENSMUST00000151863] [ENSMUST00000149187]
AlphaFold P51175
Predicted Effect probably benign
Transcript: ENSMUST00000064272
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065941
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073120
AA Change: Y348C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729
AA Change: Y348C

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111313
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142656
Predicted Effect probably damaging
Transcript: ENSMUST00000192956
AA Change: Y321C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729
AA Change: Y321C

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for the R59W knock-in mutation exhibit elevated stool porphyrin levels and reduced hepatic protoporphyrinogen oxidase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Ppox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Ppox APN 1 171277880 critical splice donor site probably null
IGL01818:Ppox APN 1 171280744 missense probably benign 0.29
IGL01899:Ppox APN 1 171277082 missense probably benign 0.00
IGL01931:Ppox APN 1 171277883 missense probably null 0.51
IGL02802:Ppox UTSW 1 171277493 nonsense probably null
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0132:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0184:Ppox UTSW 1 171279552 missense probably damaging 1.00
R0542:Ppox UTSW 1 171279244 missense probably damaging 1.00
R0615:Ppox UTSW 1 171277814 splice site probably benign
R1559:Ppox UTSW 1 171280006 intron probably benign
R3687:Ppox UTSW 1 171277493 missense probably damaging 1.00
R4941:Ppox UTSW 1 171277593 missense probably damaging 0.99
R5037:Ppox UTSW 1 171277596 missense probably damaging 1.00
R5599:Ppox UTSW 1 171277460 missense probably damaging 1.00
R5739:Ppox UTSW 1 171279996 missense probably damaging 1.00
R5791:Ppox UTSW 1 171277312 missense probably damaging 1.00
R5892:Ppox UTSW 1 171277461 missense probably damaging 0.98
R7564:Ppox UTSW 1 171280191 missense probably benign 0.14
R7937:Ppox UTSW 1 171279972 missense possibly damaging 0.93
R7949:Ppox UTSW 1 171277948 missense probably benign 0.00
R9065:Ppox UTSW 1 171277874 critical splice donor site probably benign
R9417:Ppox UTSW 1 171280281 missense unknown
Z1177:Ppox UTSW 1 171280498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTGTAGCCAGTAACCTCCC -3'
(R):5'- CTAGCCTAGAATGAACGCCTGCTC -3'

Sequencing Primer
(F):5'- CAACATCACCTACGAGGAGACG -3'
(R):5'- TACCATCAAGGCAGTGTCTG -3'
Posted On 2013-05-23