Incidental Mutation 'R4992:Ube3a'
ID386255
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Nameubiquitin protein ligase E3A
SynonymsHpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location59228750-59311536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59284820 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 560 (D560E)
Ref Sequence ENSEMBL: ENSMUSP00000143962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200758] [ENSMUST00000202945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107537
AA Change: D560E

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: D560E

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200758
AA Change: D581E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: D581E

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202207
Predicted Effect probably benign
Transcript: ENSMUST00000202247
Predicted Effect probably benign
Transcript: ENSMUST00000202288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202776
Predicted Effect possibly damaging
Transcript: ENSMUST00000202945
AA Change: D560E

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: D560E

DomainStartEndE-ValueType
Pfam:AZUL 6 60 4.4e-21 PFAM
Blast:HECTc 87 148 2e-20 BLAST
low complexity region 149 186 N/A INTRINSIC
Blast:HECTc 338 459 1e-12 BLAST
HECTc 519 762 7.07e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207816
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 59272110 missense probably damaging 1.00
IGL00886:Ube3a APN 7 59284737 missense probably damaging 1.00
IGL02037:Ube3a APN 7 59275758 unclassified probably benign
IGL02127:Ube3a APN 7 59276041 missense probably benign 0.03
IGL02228:Ube3a APN 7 59288396 splice site probably benign
IGL02533:Ube3a APN 7 59304832 missense probably damaging 1.00
IGL02706:Ube3a APN 7 59272133 missense possibly damaging 0.67
IGL03037:Ube3a APN 7 59247223 splice site probably benign
IGL03213:Ube3a APN 7 59286122 nonsense probably null
IGL03306:Ube3a APN 7 59286147 missense probably damaging 1.00
Kebab UTSW 7 59288488 missense probably damaging 1.00
Shawarma UTSW 7 59276183 nonsense probably null
PIT4362001:Ube3a UTSW 7 59276122 missense possibly damaging 0.86
R0847:Ube3a UTSW 7 59276586 missense possibly damaging 0.80
R1765:Ube3a UTSW 7 59286114 missense probably damaging 1.00
R1771:Ube3a UTSW 7 59275966 missense probably damaging 1.00
R1926:Ube3a UTSW 7 59276379 missense probably damaging 1.00
R1992:Ube3a UTSW 7 59303787 missense probably damaging 1.00
R2026:Ube3a UTSW 7 59303726 missense probably damaging 1.00
R2104:Ube3a UTSW 7 59276477 missense possibly damaging 0.95
R3176:Ube3a UTSW 7 59276519 nonsense probably null
R3276:Ube3a UTSW 7 59276519 nonsense probably null
R3623:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3624:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3690:Ube3a UTSW 7 59276799 missense probably damaging 1.00
R4423:Ube3a UTSW 7 59276113 missense probably benign 0.10
R4583:Ube3a UTSW 7 59286063 missense probably damaging 1.00
R4883:Ube3a UTSW 7 59243450 start codon destroyed probably benign 0.21
R5175:Ube3a UTSW 7 59288717 missense probably damaging 1.00
R5397:Ube3a UTSW 7 59286912 missense probably benign 0.26
R5545:Ube3a UTSW 7 59272024 missense probably damaging 1.00
R5572:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R5635:Ube3a UTSW 7 59288488 missense probably damaging 1.00
R5766:Ube3a UTSW 7 59276059 missense possibly damaging 0.89
R5890:Ube3a UTSW 7 59272028 missense probably damaging 1.00
R5956:Ube3a UTSW 7 59277020 unclassified probably benign
R6388:Ube3a UTSW 7 59304921 unclassified probably null
R6464:Ube3a UTSW 7 59276183 nonsense probably null
R6467:Ube3a UTSW 7 59276902 missense probably damaging 1.00
R6474:Ube3a UTSW 7 59287024 missense probably damaging 1.00
R6669:Ube3a UTSW 7 59276857 missense probably benign 0.02
R7003:Ube3a UTSW 7 59276440 missense probably damaging 1.00
R7044:Ube3a UTSW 7 59288413 missense probably damaging 1.00
R7187:Ube3a UTSW 7 59275905 missense probably benign 0.02
R7360:Ube3a UTSW 7 59276635 missense probably damaging 1.00
R7363:Ube3a UTSW 7 59287003 missense probably benign 0.00
R7508:Ube3a UTSW 7 59303689 missense possibly damaging 0.84
R7652:Ube3a UTSW 7 59243354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTACATACTCTTGTGTGTTG -3'
(R):5'- AACCTATGATTCTCATGACTTCAGG -3'

Sequencing Primer
(F):5'- CTTGTGTGTTGAAATAAATCTTGCC -3'
(R):5'- GACTTCAGGTTTTCAAATCTACCAC -3'
Posted On2016-05-10