Incidental Mutation 'R4992:D930020B18Rik'
ID386274
Institutional Source Beutler Lab
Gene Symbol D930020B18Rik
Ensembl Gene ENSMUSG00000047642
Gene NameRIKEN cDNA D930020B18 gene
Synonyms
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121641588-121693915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121654761 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 89 (P89A)
Ref Sequence ENSEMBL: ENSMUSP00000121976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120642] [ENSMUST00000132744] [ENSMUST00000140802] [ENSMUST00000142501]
Predicted Effect probably damaging
Transcript: ENSMUST00000120642
AA Change: P89A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113963
Gene: ENSMUSG00000047642
AA Change: P89A

DomainStartEndE-ValueType
Pfam:DUF4551 11 617 3.2e-237 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132744
AA Change: P71A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118274
Gene: ENSMUSG00000047642
AA Change: P71A

DomainStartEndE-ValueType
Pfam:DUF4551 1 148 3.6e-66 PFAM
Pfam:DUF4551 142 443 6.1e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140802
AA Change: P89A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121976
Gene: ENSMUSG00000047642
AA Change: P89A

DomainStartEndE-ValueType
Pfam:DUF4551 1 151 8.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142501
SMART Domains Protein: ENSMUSP00000118939
Gene: ENSMUSG00000047642

DomainStartEndE-ValueType
Pfam:DUF4551 1 182 1.3e-74 PFAM
Meta Mutation Damage Score 0.2265 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in D930020B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:D930020B18Rik APN 10 121685584 missense probably damaging 1.00
IGL01669:D930020B18Rik APN 10 121683961 missense probably benign 0.03
IGL01793:D930020B18Rik APN 10 121671831 missense probably damaging 1.00
IGL01907:D930020B18Rik APN 10 121642010 missense probably damaging 0.97
IGL01981:D930020B18Rik APN 10 121692414 missense probably damaging 0.98
IGL02545:D930020B18Rik APN 10 121689933 missense possibly damaging 0.87
IGL03024:D930020B18Rik APN 10 121685622 splice site probably benign
R0022:D930020B18Rik UTSW 10 121671770 missense probably damaging 0.97
R0023:D930020B18Rik UTSW 10 121689821 missense probably damaging 0.99
R1872:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
R2340:D930020B18Rik UTSW 10 121654836 missense probably damaging 1.00
R4074:D930020B18Rik UTSW 10 121656218 intron probably benign
R4990:D930020B18Rik UTSW 10 121654761 missense probably damaging 1.00
R4990:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R4992:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R5096:D930020B18Rik UTSW 10 121667804 missense probably benign 0.19
R5677:D930020B18Rik UTSW 10 121669201 missense probably benign 0.00
R6401:D930020B18Rik UTSW 10 121641857 missense possibly damaging 0.95
R6481:D930020B18Rik UTSW 10 121661148 critical splice donor site probably null
R7070:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
R7250:D930020B18Rik UTSW 10 121671831 missense probably damaging 1.00
R7408:D930020B18Rik UTSW 10 121689834 missense probably damaging 1.00
R7446:D930020B18Rik UTSW 10 121667745 missense possibly damaging 0.94
X0021:D930020B18Rik UTSW 10 121641885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAAAACGCCATGGGTGCTTC -3'
(R):5'- AACGCTTATGCAACGTCCCC -3'

Sequencing Primer
(F):5'- CTTACAGGTTCAGAGATTCAGGC -3'
(R):5'- GCTTATGCAACGTCCCCCATAC -3'
Posted On2016-05-10