Incidental Mutation 'R4992:Rnf112'
ID386278
Institutional Source Beutler Lab
Gene Symbol Rnf112
Ensembl Gene ENSMUSG00000010086
Gene Namering finger protein 112
SynonymsZfp179, bfp
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61448442-61454131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61452711 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 100 (I100F)
Ref Sequence ENSEMBL: ENSMUSP00000099722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054927
AA Change: I123F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: I123F

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 423 1.3e-21 PFAM
low complexity region 541 557 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060255
AA Change: I123F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: I123F

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 448 2.8e-21 PFAM
low complexity region 566 582 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102661
AA Change: I100F

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: I100F

DomainStartEndE-ValueType
RING 57 97 1.7e-7 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:GBP 148 400 2.7e-19 PFAM
low complexity region 518 534 N/A INTRINSIC
transmembrane domain 547 569 N/A INTRINSIC
transmembrane domain 582 604 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152137
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Rnf112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rnf112 APN 11 61452784 missense probably damaging 1.00
IGL01339:Rnf112 APN 11 61450477 missense probably benign 0.00
IGL01469:Rnf112 APN 11 61451341 missense possibly damaging 0.94
IGL02102:Rnf112 APN 11 61452015 missense probably benign 0.36
IGL02216:Rnf112 APN 11 61449978 missense probably damaging 1.00
IGL02431:Rnf112 APN 11 61450379 missense probably benign 0.17
IGL02638:Rnf112 APN 11 61449405 utr 3 prime probably benign
IGL02657:Rnf112 APN 11 61450252 splice site probably null
R0041:Rnf112 UTSW 11 61452355 missense probably damaging 1.00
R1514:Rnf112 UTSW 11 61450410 missense probably benign 0.01
R1991:Rnf112 UTSW 11 61452426 missense probably damaging 1.00
R2119:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R2216:Rnf112 UTSW 11 61452279 missense probably damaging 1.00
R2880:Rnf112 UTSW 11 61450467 missense possibly damaging 0.89
R3775:Rnf112 UTSW 11 61450185 splice site probably benign
R3904:Rnf112 UTSW 11 61450385 missense probably damaging 1.00
R4646:Rnf112 UTSW 11 61452110 missense probably damaging 0.99
R4710:Rnf112 UTSW 11 61449831 missense probably damaging 1.00
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4894:Rnf112 UTSW 11 61452662 missense probably damaging 1.00
R4930:Rnf112 UTSW 11 61453465 missense probably benign
R4967:Rnf112 UTSW 11 61452926 splice site probably benign
R5547:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R5874:Rnf112 UTSW 11 61449447 missense probably damaging 0.98
R5997:Rnf112 UTSW 11 61451022 missense possibly damaging 0.87
R6023:Rnf112 UTSW 11 61449729 missense probably damaging 1.00
R6906:Rnf112 UTSW 11 61450389 missense probably null 0.38
R7194:Rnf112 UTSW 11 61450857 missense probably damaging 1.00
R7439:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAGTTGAGAGTCCAGCCTG -3'
(R):5'- CCAGGTCCCATGCATCATTC -3'

Sequencing Primer
(F):5'- AGCCTGGAACTCTCTGCC -3'
(R):5'- TGCATCATTCCCCAAGCTGGAG -3'
Posted On2016-05-10