Incidental Mutation 'R0426:Intu'
ID 38629
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 038628-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0426 (G1)
Quality Score 158
Status Validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40629735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 355 (C355Y)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably damaging
Transcript: ENSMUST00000091186
AA Change: C355Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: C355Y

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204176
AA Change: C78Y
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,845,853 (GRCm39) probably benign Het
Acadl A T 1: 66,880,805 (GRCm39) F320L probably damaging Het
Acsbg1 T C 9: 54,530,030 (GRCm39) D222G probably benign Het
Anapc15 A G 7: 101,547,240 (GRCm39) T39A probably benign Het
Ano3 A T 2: 110,491,519 (GRCm39) V919E probably damaging Het
Arhgef12 T C 9: 42,882,286 (GRCm39) probably null Het
Atad5 T A 11: 80,003,658 (GRCm39) I1091N probably benign Het
Atf1 A T 15: 100,130,708 (GRCm39) H26L possibly damaging Het
Atp10a T C 7: 58,434,482 (GRCm39) M252T probably benign Het
Btbd8 C T 5: 107,658,239 (GRCm39) T1603I probably damaging Het
Cd55 C T 1: 130,376,109 (GRCm39) R347H probably benign Het
Cdc27 A C 11: 104,403,853 (GRCm39) probably null Het
Cdh9 G A 15: 16,823,540 (GRCm39) probably null Het
Cdk11b T C 4: 155,726,969 (GRCm39) probably benign Het
Cep70 A G 9: 99,179,737 (GRCm39) D567G probably benign Het
Cep78 A T 19: 15,948,334 (GRCm39) Y382* probably null Het
Cgas G A 9: 78,343,020 (GRCm39) probably benign Het
Col9a2 T C 4: 120,901,857 (GRCm39) probably benign Het
Cyp2d12 G A 15: 82,443,164 (GRCm39) D409N probably benign Het
Ddx39a A G 8: 84,448,398 (GRCm39) T217A probably benign Het
Dennd1b T A 1: 139,097,934 (GRCm39) D733E probably benign Het
Dicer1 A G 12: 104,668,801 (GRCm39) S1294P probably damaging Het
Dnah3 T C 7: 119,542,795 (GRCm39) E3539G probably benign Het
Dnmbp A G 19: 43,840,875 (GRCm39) probably benign Het
Dysf T C 6: 84,126,739 (GRCm39) L1332P probably damaging Het
F5 A G 1: 164,010,409 (GRCm39) D380G probably damaging Het
Fam171a1 T C 2: 3,226,433 (GRCm39) V522A probably benign Het
Fhip1b A C 7: 105,038,680 (GRCm39) C186W probably damaging Het
Galr2 C A 11: 116,172,517 (GRCm39) A69D probably damaging Het
Grk2 T C 19: 4,340,628 (GRCm39) probably null Het
Gtf3c1 A T 7: 125,262,188 (GRCm39) Y1119* probably null Het
Hgd A T 16: 37,409,047 (GRCm39) probably benign Het
Ildr2 G T 1: 166,136,468 (GRCm39) V436L probably benign Het
Irf2bpl G T 12: 86,929,870 (GRCm39) P268T probably benign Het
Jarid2 T C 13: 44,994,358 (GRCm39) probably null Het
Jup A T 11: 100,263,227 (GRCm39) M716K probably benign Het
Kank1 G A 19: 25,388,837 (GRCm39) V809I probably damaging Het
Kdm1b T A 13: 47,217,720 (GRCm39) probably benign Het
Kdm3a C T 6: 71,577,739 (GRCm39) C687Y probably damaging Het
Kdm5d T A Y: 942,437 (GRCm39) probably benign Het
Kifap3 T A 1: 163,693,121 (GRCm39) probably benign Het
Macf1 T A 4: 123,377,453 (GRCm39) K1400* probably null Het
Majin A G 19: 6,262,147 (GRCm39) probably benign Het
Mctp1 A G 13: 77,168,940 (GRCm39) I846V probably benign Het
Mrgpra2b T A 7: 47,113,875 (GRCm39) I286F possibly damaging Het
Neil3 T G 8: 54,062,431 (GRCm39) probably benign Het
Nox3 G T 17: 3,745,838 (GRCm39) N23K probably damaging Het
Nt5c3 T C 6: 56,860,797 (GRCm39) K219E probably benign Het
Or1e29 T A 11: 73,667,263 (GRCm39) M297L probably benign Het
Or52b4i T A 7: 102,191,893 (GRCm39) I250N probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or6b13 A C 7: 139,782,029 (GRCm39) F218C possibly damaging Het
Or6d13 A T 6: 116,517,446 (GRCm39) N11Y probably damaging Het
Or8g34 T C 9: 39,372,889 (GRCm39) L54P probably damaging Het
Pacsin2 A G 15: 83,263,996 (GRCm39) V347A possibly damaging Het
Pcdhb7 A T 18: 37,475,857 (GRCm39) E331V probably damaging Het
Pcid2 A C 8: 13,131,262 (GRCm39) probably null Het
Pcsk9 T C 4: 106,307,274 (GRCm39) D323G possibly damaging Het
Pdhb T C 14: 8,169,801 (GRCm38) E203G probably damaging Het
Phlpp2 A G 8: 110,655,095 (GRCm39) Y630C probably benign Het
Pidd1 C T 7: 141,019,046 (GRCm39) A812T probably damaging Het
Plau G A 14: 20,892,382 (GRCm39) R389H probably benign Het
Plekhg6 G A 6: 125,341,592 (GRCm39) probably null Het
Ppox T C 1: 171,105,322 (GRCm39) Y321C probably damaging Het
Pxdn A G 12: 30,037,065 (GRCm39) N281S possibly damaging Het
Pycr3 A T 15: 75,790,237 (GRCm39) M138K probably benign Het
Radil T C 5: 142,483,628 (GRCm39) Y526C probably damaging Het
Ranbp3 C A 17: 57,014,169 (GRCm39) D233E probably benign Het
Rhpn1 A G 15: 75,583,721 (GRCm39) Q402R possibly damaging Het
Sec23b T A 2: 144,410,532 (GRCm39) probably benign Het
Sel1l2 A T 2: 140,082,832 (GRCm39) L602* probably null Het
Sema5b G A 16: 35,466,725 (GRCm39) G209D probably damaging Het
Svep1 T C 4: 58,073,333 (GRCm39) Y1992C possibly damaging Het
Syncrip T A 9: 88,338,312 (GRCm39) probably benign Het
Synj1 G T 16: 90,764,242 (GRCm39) A65E probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tecrl T C 5: 83,502,610 (GRCm39) probably benign Het
Tenm4 G T 7: 96,427,058 (GRCm39) G698C probably damaging Het
Tmem209 G A 6: 30,491,181 (GRCm39) L259F probably damaging Het
Tmem247 G A 17: 87,225,931 (GRCm39) E124K possibly damaging Het
Tnks2 C A 19: 36,830,221 (GRCm39) A218E probably damaging Het
Tppp T A 13: 74,169,430 (GRCm39) F57I probably damaging Het
Trim36 A G 18: 46,305,592 (GRCm39) W452R probably damaging Het
Vars2 A T 17: 35,975,476 (GRCm39) V262E probably damaging Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Zfp516 G T 18: 82,973,897 (GRCm39) A32S probably benign Het
Zfy2 G T Y: 2,107,348 (GRCm39) L429I possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAGGCATAACTCTGTCCGTGATTG -3'
(R):5'- AATGATGTGGGACCATCCCAGACC -3'

Sequencing Primer
(F):5'- CTCTGACTAAAGCTGAGGCTG -3'
(R):5'- GGACCATCCCAGACCTATAGC -3'
Posted On 2013-05-23