Incidental Mutation 'R4992:Mgat3'
ID 386299
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Name mannoside acetylglucosaminyltransferase 3
Synonyms GnT-III, 1110038J12Rik
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R4992 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 80173721-80215519 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80212542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 523 (D523E)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044970
AA Change: D523E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: D523E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R3081:Mgat3 UTSW 15 80211854 missense probably benign 0.33
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6508:Mgat3 UTSW 15 80212024 missense possibly damaging 0.90
R6784:Mgat3 UTSW 15 80212200 missense probably damaging 0.98
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
R7592:Mgat3 UTSW 15 80210992 missense probably damaging 0.96
R7774:Mgat3 UTSW 15 80211542 missense probably damaging 0.96
R7819:Mgat3 UTSW 15 80211772 nonsense probably null
R8559:Mgat3 UTSW 15 80212169 missense probably damaging 1.00
R8678:Mgat3 UTSW 15 80212271 missense possibly damaging 0.74
R9285:Mgat3 UTSW 15 80212337 missense probably damaging 1.00
R9483:Mgat3 UTSW 15 80211440 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACATCCGCAGCTTGATCCG -3'
(R):5'- CCTGACCCTTAATTCTAGAGGCC -3'

Sequencing Primer
(F):5'- AGCTTGATCCGCACTGGG -3'
(R):5'- CTTAATTCTAGAGGCCTGAGCACAG -3'
Posted On 2016-05-10