Incidental Mutation 'R4992:Polq'
ID 386303
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock # R4992 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 37011786-37095417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37061162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1229 (N1229K)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000054034
AA Change: N1229K

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: N1229K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: N950K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: N950K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
R0013_Polq_667 UTSW 16 37061839 missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 37013181 missense probably damaging 1.00
R4280_polq_867 UTSW 16 37082057 missense probably damaging 1.00
G1Funyon:Polq UTSW 16 37061819 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
R7509:Polq UTSW 16 37060343 missense probably benign
R7509:Polq UTSW 16 37060344 missense probably benign 0.00
R7575:Polq UTSW 16 37091134 missense probably benign 0.00
R7785:Polq UTSW 16 37027877 missense probably damaging 1.00
R7787:Polq UTSW 16 37017309 missense probably damaging 1.00
R7891:Polq UTSW 16 37027882 missense probably damaging 1.00
R7898:Polq UTSW 16 37044883 missense probably damaging 0.98
R7917:Polq UTSW 16 37065288 missense probably benign 0.08
R7940:Polq UTSW 16 37060642 missense probably benign 0.27
R8028:Polq UTSW 16 37061316 missense possibly damaging 0.82
R8114:Polq UTSW 16 37042215 missense possibly damaging 0.94
R8144:Polq UTSW 16 37029484 missense probably benign 0.01
R8288:Polq UTSW 16 37027910 missense probably damaging 1.00
R8301:Polq UTSW 16 37061819 missense probably damaging 1.00
R8341:Polq UTSW 16 37071771 missense possibly damaging 0.96
R8348:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8448:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8815:Polq UTSW 16 37033531 missense probably damaging 1.00
R8843:Polq UTSW 16 37011918 missense unknown
R8878:Polq UTSW 16 37040507 missense probably benign 0.02
R9016:Polq UTSW 16 37022797 missense probably damaging 1.00
R9189:Polq UTSW 16 37044903 missense probably damaging 1.00
R9209:Polq UTSW 16 37048649 missense possibly damaging 0.94
R9352:Polq UTSW 16 37041890 missense probably damaging 0.98
R9398:Polq UTSW 16 37061032 missense probably benign 0.02
R9403:Polq UTSW 16 37061853 missense probably benign 0.00
R9489:Polq UTSW 16 37022811 missense probably benign 0.00
R9605:Polq UTSW 16 37022811 missense probably benign 0.00
R9664:Polq UTSW 16 37027814 missense probably damaging 0.98
R9801:Polq UTSW 16 37092828 missense probably damaging 1.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Z1176:Polq UTSW 16 37042257 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCTGCTAGAGACAGAAG -3'
(R):5'- GGCTGGGTTAGAAGCATGAC -3'

Sequencing Primer
(F):5'- CAGAAGAGGACTGGCTGCTC -3'
(R):5'- GGTTAGAAGCATGACTATGTTCAG -3'
Posted On 2016-05-10