Mutagenetix > Incidental Mutations

Incidental Mutation 'R4651:Trim24'

386318

Institutional Source

Beutler Lab

Gene Symbol

Trim24

Ensembl Gene

ENSMUSG00000029833

Gene Name

tripartite motif-containing 24

Synonyms

A130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a

MMRRC Submission

041911-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4651 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37870811-37966296 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 37957839 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]

Predicted Effect

probably null
Transcript: ENSMUST00000031859

SMART Domains

Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	2.5e-10	SMART
BBOX	158	205	2e-13	SMART
BBOX	218	259	7e-14	SMART
BBC	266	392	3e-44	SMART
low complexity region	474	491	N/A	INTRINSIC
low complexity region	501	514	N/A	INTRINSIC
low complexity region	573	598	N/A	INTRINSIC
low complexity region	686	709	N/A	INTRINSIC
low complexity region	759	774	N/A	INTRINSIC
PHD	829	872	2.1e-13	SMART
BROMO	902	1007	2.4e-40	SMART
low complexity region	1025	1033	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120238

SMART Domains

Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833

Domain	Start	End	E-Value	Type
BBOX	88	135	2e-13	SMART
BBOX	148	189	6.8e-14	SMART
BBC	196	322	3e-44	SMART
low complexity region	404	421	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	616	639	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
PHD	759	802	2e-13	SMART
BROMO	832	937	2.4e-40	SMART
low complexity region	955	963	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120428

SMART Domains

Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	5.22e-8	SMART
BBOX	158	205	6.27e-11	SMART
BBOX	218	259	2.22e-11	SMART
BBC	266	392	5.86e-42	SMART
low complexity region	539	564	N/A	INTRINSIC
low complexity region	652	675	N/A	INTRINSIC
low complexity region	725	740	N/A	INTRINSIC
PHD	795	838	3.15e-11	SMART
BROMO	868	973	3.95e-38	SMART
low complexity region	991	999	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135387

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Ahnak2	T	G	12: 112,774,837	S128R	possibly damaging	Het
Ankrd26	T	C	6: 118,515,826	D1319G	probably benign	Het
Ankrd35	T	C	3: 96,684,027	V543A	probably benign	Het
Ano10	A	T	9: 122,261,115	Y377*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp10b	G	A	11: 43,194,645	G284S	probably damaging	Het
Atp5c1	A	G	2: 10,063,476	F180S	probably damaging	Het
Btnl4	A	G	17: 34,472,628	S296P	probably benign	Het
Cast	A	G	13: 74,746,014	S171P	probably benign	Het
Catsperb	G	A	12: 101,541,512	A513T	probably benign	Het
Ccnf	C	A	17: 24,231,786	R406L	probably damaging	Het
Ceacam12	A	G	7: 18,067,434	T113A	probably damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Col12a1	A	T	9: 79,612,946	D2815E	probably damaging	Het
Cpox	G	T	16: 58,670,687	R87L	possibly damaging	Het
Cttnbp2	A	G	6: 18,434,038	I607T	possibly damaging	Het
Cux1	A	T	5: 136,567,229	N4K	probably damaging	Het
Cyp3a25	T	C	5: 145,994,891	T136A	probably benign	Het
Dhx58	T	A	11: 100,701,359	N288Y	probably damaging	Het
Dnah10	T	C	5: 124,729,143	Y127H	probably benign	Het
Dnd1	G	A	18: 36,765,061		probably benign	Het
Ehmt2	C	A	17: 34,913,814	N1171K	probably damaging	Het
Fanci	T	A	7: 79,435,256	M838K	possibly damaging	Het
Flot1	T	C	17: 35,832,544		probably benign	Het
Gad2	A	T	2: 22,668,362	D364V	probably damaging	Het
Gm10375	C	A	14: 43,606,869		probably null	Het
Gm9996	T	A	10: 29,143,758		probably benign	Het
Gnat3	T	A	5: 18,015,570	L247H	probably damaging	Het
Ip6k3	C	T	17: 27,145,291	C261Y	probably damaging	Het
Irgc1	C	A	7: 24,432,813	R193L	probably damaging	Het
Kalrn	G	T	16: 34,176,391	P1477Q	probably damaging	Het
Kyat1	G	T	2: 30,194,064	H15N	probably benign	Het
Lamc1	T	G	1: 153,228,777	S59R	probably damaging	Het
Llgl1	A	G	11: 60,708,651	D486G	possibly damaging	Het
Lrrc9	T	C	12: 72,477,386	W790R	probably damaging	Het
Lsm2	T	A	17: 34,985,595		probably benign	Het
Med8	A	T	4: 118,410,892	E5V	probably damaging	Het
Mefv	A	G	16: 3,717,818	L82P	probably damaging	Het
Mettl3	T	A	14: 52,295,092	I545F	probably damaging	Het
Naa20	CTCTAGA	C	2: 145,911,832		probably benign	Het
Ncapg2	T	A	12: 116,425,787	N342K	probably damaging	Het
Ndufaf6	T	A	4: 11,062,070	Y187F	probably damaging	Het
Nomo1	T	A	7: 46,068,442	I799N	probably damaging	Het
Obscn	G	A	11: 59,038,877	R5824C	probably damaging	Het
Olfr1310	G	T	2: 112,008,250	S312Y	probably damaging	Het
Olfr430	A	G	1: 174,069,828	I177V	possibly damaging	Het
Olfr807	T	C	10: 129,755,418	I11V	probably benign	Het
Olfr849	T	A	9: 19,441,295	C127*	probably null	Het
Pgm3	T	A	9: 86,558,470	R389S	probably benign	Het
Pkd2l2	A	T	18: 34,409,836	R20*	probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Ppp4r3a	T	A	12: 101,082,911		probably benign	Het
Prpf38b	G	A	3: 108,904,092		probably benign	Het
Prpf4b	A	T	13: 34,899,971	M908L	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
Prrc2c	A	T	1: 162,723,274	H40Q	probably damaging	Het
Ptprk	T	C	10: 28,263,690	I137T	probably damaging	Het
Rrnad1	T	C	3: 87,927,672	H107R	probably benign	Het
Sdr42e1	T	C	8: 117,663,621	T94A	probably benign	Het
Setd2	A	G	9: 110,594,132	D2085G	possibly damaging	Het
Sgce	T	C	6: 4,689,560		probably benign	Het
Shisa3	A	G	5: 67,608,649	D81G	probably damaging	Het
Sipa1l1	T	A	12: 82,422,471	L1248*	probably null	Het
Skint7	T	G	4: 111,982,112	M201R	probably damaging	Het
Slc5a3	T	A	16: 92,077,202	V49E	probably benign	Het
Slc9c1	A	T	16: 45,547,393	*163L	probably null	Het
Smyd3	A	G	1: 179,043,741	Y358H	probably benign	Het
Srp68	A	T	11: 116,274,014	S31R	probably benign	Het
Stag1	T	A	9: 100,796,716	M230K	probably damaging	Het
Strc	A	T	2: 121,374,348	D985E	possibly damaging	Het
Syne2	A	G	12: 75,989,239	T3767A	probably damaging	Het
Sytl2	C	A	7: 90,375,425	P207Q	probably damaging	Het
Tbc1d2b	A	G	9: 90,207,887	F863S	probably damaging	Het
Tek	T	C	4: 94,780,884	S41P	probably damaging	Het
Top1	T	C	2: 160,712,717	Y463H	probably damaging	Het
Trim38	A	T	13: 23,782,969	D133V	probably damaging	Het
Ttn	A	G	2: 76,746,635	V24638A	possibly damaging	Het
Ttn	A	G	2: 76,870,869		probably benign	Het
Tyro3	G	C	2: 119,816,868	G826A	probably benign	Het
Ube2b	A	G	11: 51,995,372		probably null	Het
Ubxn4	T	A	1: 128,274,850	W410R	probably benign	Het
Unc45a	T	C	7: 80,333,029	K383E	possibly damaging	Het
Usp7	A	C	16: 8,698,414		probably benign	Het
Vmn1r193	C	T	13: 22,219,525	G99D	probably damaging	Het
Vrk2	T	C	11: 26,489,803	D256G	probably damaging	Het
Wdr81	A	G	11: 75,451,240	V1067A	probably damaging	Het
Wiz	C	T	17: 32,357,681	R624Q	probably damaging	Het
Zcwpw2	A	G	9: 118,014,051		noncoding transcript	Het

Other mutations in Trim24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Trim24	APN	6	37903648	missense	possibly damaging	0.76
IGL01307:Trim24	APN	6	37965635	missense	possibly damaging	0.81
IGL01790:Trim24	APN	6	37945613	missense	probably benign
IGL02525:Trim24	APN	6	37945718	missense	probably damaging	0.99
IGL02557:Trim24	APN	6	37965499	critical splice acceptor site	probably null
IGL02671:Trim24	APN	6	37960784	missense	probably damaging	1.00
IGL02795:Trim24	APN	6	37919389	missense	probably damaging	1.00
IGL02877:Trim24	APN	6	37965646	missense	probably damaging	1.00
IGL02889:Trim24	APN	6	37957761	missense	probably benign	0.02
IGL02930:Trim24	APN	6	37951445	splice site	probably benign
IGL03076:Trim24	APN	6	37965632	missense	probably damaging	0.98
accomodating	UTSW	6	37919397	missense	probably damaging	1.00
Lithe	UTSW	6	37958569	missense	probably damaging	1.00
Nervous	UTSW	6	37957729	missense	probably damaging	1.00
pliant	UTSW	6	37919491	critical splice donor site	probably null
qualmish	UTSW	6	37903652	critical splice donor site	probably null
Queasy	UTSW	6	37908305	missense	probably damaging	0.99
squeamish	UTSW	6	37915202	nonsense	probably null
uneasy	UTSW	6	37956477	critical splice donor site	probably null
PIT4651001:Trim24	UTSW	6	37900732	critical splice donor site	probably null
R0037:Trim24	UTSW	6	37957549	missense	probably damaging	1.00
R0037:Trim24	UTSW	6	37957549	missense	probably damaging	1.00
R0183:Trim24	UTSW	6	37943480	missense	possibly damaging	0.90
R0471:Trim24	UTSW	6	37915195	missense	possibly damaging	0.94
R0485:Trim24	UTSW	6	37957066	missense	probably damaging	1.00
R0606:Trim24	UTSW	6	37871234	missense	probably benign
R0609:Trim24	UTSW	6	37957783	missense	probably damaging	1.00
R0637:Trim24	UTSW	6	37958559	splice site	probably null
R0734:Trim24	UTSW	6	37919465	missense	possibly damaging	0.86
R0855:Trim24	UTSW	6	37915202	nonsense	probably null
R1131:Trim24	UTSW	6	37957782	missense	probably damaging	1.00
R1141:Trim24	UTSW	6	37915293	missense	probably damaging	1.00
R1159:Trim24	UTSW	6	37956477	critical splice donor site	probably null
R1460:Trim24	UTSW	6	37964826	missense	probably damaging	1.00
R1672:Trim24	UTSW	6	37915279	missense	probably damaging	1.00
R1868:Trim24	UTSW	6	37951512	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37957078	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37957078	missense	probably damaging	0.99
R1894:Trim24	UTSW	6	37957078	missense	probably damaging	0.99
R1913:Trim24	UTSW	6	37957815	missense	probably damaging	1.00
R2254:Trim24	UTSW	6	37958677	missense	probably benign
R2511:Trim24	UTSW	6	37903652	critical splice donor site	probably null
R2849:Trim24	UTSW	6	37956453	missense	probably damaging	0.99
R3878:Trim24	UTSW	6	37964773	missense	probably benign	0.14
R4084:Trim24	UTSW	6	37915257	missense	probably damaging	1.00
R4235:Trim24	UTSW	6	37964740	missense	probably damaging	1.00
R4292:Trim24	UTSW	6	37900692	missense	possibly damaging	0.91
R4633:Trim24	UTSW	6	37956436	missense	probably damaging	0.98
R4652:Trim24	UTSW	6	37957839	critical splice donor site	probably null
R4686:Trim24	UTSW	6	37908305	missense	probably damaging	0.99
R5000:Trim24	UTSW	6	37958612	missense	probably benign	0.01
R5213:Trim24	UTSW	6	37957075	missense	probably damaging	0.99
R5258:Trim24	UTSW	6	37919400	missense	probably damaging	0.99
R5292:Trim24	UTSW	6	37903604	missense	probably benign	0.23
R5395:Trim24	UTSW	6	37957744	missense	probably damaging	1.00
R5547:Trim24	UTSW	6	37965550	missense	probably damaging	1.00
R5666:Trim24	UTSW	6	37965601	missense	probably benign	0.19
R5670:Trim24	UTSW	6	37965601	missense	probably benign	0.19
R5849:Trim24	UTSW	6	37957729	missense	probably damaging	1.00
R5927:Trim24	UTSW	6	37958569	missense	probably damaging	1.00
R5932:Trim24	UTSW	6	37957075	missense	probably damaging	0.99
R6286:Trim24	UTSW	6	37919491	critical splice donor site	probably null
R6374:Trim24	UTSW	6	37953549	missense	probably benign	0.12
R6449:Trim24	UTSW	6	37903652	critical splice donor site	probably null
R6723:Trim24	UTSW	6	37951468	missense	probably benign	0.00
R6731:Trim24	UTSW	6	37943485	missense	probably damaging	0.99
R6975:Trim24	UTSW	6	37919492	critical splice donor site	probably null
R7000:Trim24	UTSW	6	37958678	missense	probably benign	0.24
R7067:Trim24	UTSW	6	37957840	splice site	probably null
R7126:Trim24	UTSW	6	37919457	missense	probably damaging	1.00
R7162:Trim24	UTSW	6	37965521	missense	possibly damaging	0.68
R7486:Trim24	UTSW	6	37957839	critical splice donor site	probably null
R7779:Trim24	UTSW	6	37919397	missense	probably damaging	1.00
R7779:Trim24	UTSW	6	37919398	missense	probably damaging	0.99
R8070:Trim24	UTSW	6	37957726	missense	probably damaging	0.99
R8096:Trim24	UTSW	6	37958657	missense	probably benign	0.03
R8184:Trim24	UTSW	6	37871307	missense	probably damaging	1.00
R8323:Trim24	UTSW	6	37915298	critical splice donor site	probably null
RF007:Trim24	UTSW	6	37953536	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGTCTGAGTGGTCGGATGC -3'
(R):5'- CTGGAGTATACGTCTGTGCC -3'

Sequencing Primer
(F):5'- TCGGATGCCTCCCAGAAGTC -3'
(R):5'- CTAGCACTATGCCACACT -3'

Posted On

2016-05-11