Incidental Mutation 'R4651:Mettl3'
ID386321
Institutional Source Beutler Lab
Gene Symbol Mettl3
Ensembl Gene ENSMUSG00000022160
Gene Namemethyltransferase like 3
SynonymsM6A, 2310024F18Rik, Spo8
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4651 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52294841-52305128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52295092 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 545 (I545F)
Ref Sequence ENSEMBL: ENSMUSP00000022767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000122962] [ENSMUST00000147768] [ENSMUST00000153539] [ENSMUST00000173138] [ENSMUST00000173896] [ENSMUST00000174351] [ENSMUST00000174853]
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022767
AA Change: I545F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160
AA Change: I545F

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130550
Predicted Effect probably benign
Transcript: ENSMUST00000147768
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152493
Predicted Effect probably benign
Transcript: ENSMUST00000153539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156611
Predicted Effect probably benign
Transcript: ENSMUST00000173138
SMART Domains Protein: ENSMUSP00000134018
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173546
Predicted Effect unknown
Transcript: ENSMUST00000173656
AA Change: D52V
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160
AA Change: D52V

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173896
SMART Domains Protein: ENSMUSP00000133506
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174351
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174360
AA Change: I68F
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160
AA Change: I68F

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174853
SMART Domains Protein: ENSMUSP00000133864
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 120 142 N/A INTRINSIC
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 with a deficiency in adopting the epiblast egg cylinder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Mettl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Mettl3 APN 14 52296967 unclassified probably benign
IGL00508:Mettl3 APN 14 52294979 unclassified probably benign
R0417:Mettl3 UTSW 14 52296698 missense probably damaging 1.00
R1533:Mettl3 UTSW 14 52296928 missense probably benign 0.01
R2113:Mettl3 UTSW 14 52294984 makesense probably null
R3785:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R3786:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R4652:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4938:Mettl3 UTSW 14 52299727 missense probably damaging 1.00
R5462:Mettl3 UTSW 14 52299879 missense probably damaging 0.96
R6046:Mettl3 UTSW 14 52298786 missense possibly damaging 0.91
R6151:Mettl3 UTSW 14 52295020 missense probably damaging 1.00
R6169:Mettl3 UTSW 14 52298757 missense possibly damaging 0.88
R6225:Mettl3 UTSW 14 52296758 unclassified probably null
R6282:Mettl3 UTSW 14 52297971 missense probably benign 0.01
X0025:Mettl3 UTSW 14 52298088 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACAGTCCTCTTAAGGTGTGGC -3'
(R):5'- GACACTGCCATATTATTTGCTCTGATC -3'

Sequencing Primer
(F):5'- TTAGAGATGATGCCGTCC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R46510082_PCR_F: 5’- AACAGTCCTCTTAAGGTGTGGC-3’

R46510082_PCR_R: 5’- GACACTGCCATATTATTTGCTCTGATC-3’

 

Sequencing Primers

R46510082_SEQ_F: 5’- TTAGAGATGATGCCGTCC-3’
 

R46510082_SEQ_R: 5’- CCTGGTCTACAAAGTGAGTTCCAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 592 nucleotides is amplified (NCBI RefSeq: NC_000080, chromosome 14:52294915-52295506):

 

aacagtcctc ttaaggtgtg gcctgtagcc catggctctg aacgcttagc tttgtaagga       

agtgcgtcta taaattctta ggtttagaga tgatgccgtc cggatacctt tgcttaaacc       

tggcaaccac atctgggtct agtaggtgta tcccatccag ttggtttcca agagtaatcc      

taaaacaagg gggaaagaag aggcaaacca aaaatcctgt aagggcttaa tacttaaaat      

gttctacttt ctggtgatac ctatctcagg ctgtcctgga actaactctc catgtagacc      

aggctaacct tgaactcaga gatctacttg cctctgcctc ccaagtgctg aggctaaagg      

tgtgctctac tatgcccagt ccacgtcaat ttttttggtt tggtttggtt tggtttttga      

gacagggttt ctttgtatag ccccggctga cctggaactc actttgtaga ccaggctggc      

ttcagaaatc cacctgccta tgcctcctga gtgctgggat taaaggcatg cgccaccacg      

cccggcctac atcaactttt aaaaagatca gagcaaataa tatggcagtg tc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>A).

Posted On2016-05-11