Incidental Mutation 'R4567:Gm10718'
ID386337
Institutional Source Beutler Lab
Gene Symbol Gm10718
Ensembl Gene ENSMUSG00000095186
Gene Namepredicted gene 10718
Synonyms
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R4567 (G1)
Quality Score23
Status Validated
Chromosome9
Chromosomal Location3023547-3025218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3023716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 56 (T56S)
Ref Sequence ENSEMBL: ENSMUSP00000096645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099049] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179272] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000075573
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099046
AA Change: T56S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186
AA Change: T56S

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099049
SMART Domains Protein: ENSMUSP00000096648
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 46 2.19e-9 PROSPERO
transmembrane domain 62 84 N/A INTRINSIC
internal_repeat_1 117 182 2.19e-9 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Gm10718
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01865:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01867:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01868:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01869:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01870:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01871:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01874:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01877:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01878:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01879:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01880:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01881:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01883:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01884:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01885:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01886:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01887:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01888:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01890:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01891:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01894:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01895:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01896:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01897:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01898:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01901:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01903:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01904:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01905:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01908:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01909:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01910:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01912:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01917:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01918:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01919:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01920:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01924:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01925:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01926:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01928:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01929:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01932:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01933:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01934:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01937:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01938:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01941:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01944:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01945:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01946:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01947:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01949:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01950:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01951:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01952:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01953:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01958:Gm10718 APN 9 3025118 missense probably benign 0.00
PIT4131001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
PIT4142001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
R4850:Gm10718 UTSW 9 3023716 missense probably benign 0.01
RF039:Gm10718 UTSW 9 3024385 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGGTCCTACAGTGTGCATTTC -3'
(R):5'- TCCACTGTAGGACATGGAATATG -3'

Sequencing Primer
(F):5'- CAAGTCGTCAAGTGGATGTTTCTC -3'
(R):5'- CACACTTCAGGACGTGAAATATGGC -3'
Posted On2016-05-13