Incidental Mutation 'R4719:Faim2'
ID386352
Institutional Source Beutler Lab
Gene Symbol Faim2
Ensembl Gene ENSMUSG00000023011
Gene NameFas apoptotic inhibitory molecule 2
Synonymslifeguard, NMP25, Tmbim2, Lfg, 2900002L20Rik
MMRRC Submission 041957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4719 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99497012-99528165 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 99527579 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023750] [ENSMUST00000231171]
Predicted Effect probably null
Transcript: ENSMUST00000023750
SMART Domains Protein: ENSMUSP00000023750
Gene: ENSMUSG00000023011

DomainStartEndE-ValueType
Pfam:Bax1-I 101 312 1.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230837
Predicted Effect probably null
Transcript: ENSMUST00000231171
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: A mutation in this gene results in kidney abnormalities including enlargement and dilation. A reduced seizure threshold in response to pharmacological agents is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,259,627 Y971C probably damaging Het
Actr5 T A 2: 158,626,513 S188T probably damaging Het
Adamtsl4 A G 3: 95,679,586 probably null Het
Agbl2 A G 2: 90,815,389 N822S probably benign Het
Ankdd1b T A 13: 96,417,747 probably benign Het
Arhgef40 C T 14: 52,004,938 probably benign Het
Art5 A G 7: 102,098,494 probably null Het
Cacna1s T C 1: 136,118,652 probably benign Het
Car9 G A 4: 43,508,616 W42* probably null Het
Cdh20 T C 1: 104,934,310 Y72H probably damaging Het
Ces1g T C 8: 93,317,090 D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 D73E probably benign Het
Col6a4 A T 9: 106,068,252 F888I probably damaging Het
Dgat2 T C 7: 99,158,297 D222G probably benign Het
Dscaml1 T C 9: 45,672,695 M486T probably benign Het
Fam173b T G 15: 31,608,097 V98G probably damaging Het
Fance T C 17: 28,318,319 probably benign Het
Fancm G T 12: 65,121,706 M1614I possibly damaging Het
Fcrl5 A T 3: 87,444,189 N248I probably damaging Het
Foxo3 G A 10: 42,197,778 R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 Y74H probably damaging Het
Gatd1 A C 7: 141,411,068 D55E probably benign Het
Gpr152 C A 19: 4,143,224 Q255K possibly damaging Het
Havcr1 A G 11: 46,752,441 T63A probably benign Het
Hltf T C 3: 20,064,701 probably null Het
Ifit3b A T 19: 34,612,630 Q402L probably damaging Het
Ints3 A G 3: 90,415,521 L134S probably benign Het
Kcna10 A G 3: 107,194,901 T283A probably benign Het
Kmt2e A C 5: 23,492,315 R590S probably damaging Het
Lefty1 A T 1: 180,937,712 N282Y probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lrrn2 T C 1: 132,939,177 V660A probably benign Het
Lyst T C 13: 13,650,350 S1517P probably benign Het
Mcoln2 A G 3: 146,175,713 H208R probably benign Het
Mdga2 C T 12: 66,471,001 probably benign Het
Mpp2 T A 11: 102,064,433 E122V possibly damaging Het
Mrgprb5 T C 7: 48,168,778 N70D probably damaging Het
Muc5ac A T 7: 141,789,763 E37D possibly damaging Het
Nbeal1 T A 1: 60,235,563 probably null Het
Ncoa6 T C 2: 155,391,161 probably benign Het
Nfib C A 4: 82,504,730 probably null Het
Nostrin G T 2: 69,144,812 G24* probably null Het
Nudc A G 4: 133,533,265 Y293H probably damaging Het
Olfr643 T A 7: 104,058,733 N290Y probably damaging Het
Pcmtd1 T A 1: 7,155,101 Y41* probably null Het
Pigt T C 2: 164,501,624 L340P probably damaging Het
Pomgnt1 T C 4: 116,155,775 Y420H probably damaging Het
Pramel6 C T 2: 87,510,752 T476I probably benign Het
Ptprn2 T A 12: 116,824,396 H118Q possibly damaging Het
Rasl10a G A 11: 5,058,517 S71N probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Rps4l-ps T C 7: 114,927,302 noncoding transcript Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Secisbp2 T A 13: 51,652,732 F54L possibly damaging Het
Senp1 A T 15: 98,056,850 H484Q probably benign Het
Slc12a1 T C 2: 125,153,993 I22T possibly damaging Het
Slc25a36 A G 9: 97,090,119 probably benign Het
Srcap T A 7: 127,541,559 S1443T probably benign Het
Sv2c T C 13: 95,986,811 T385A probably benign Het
Tas2r131 T A 6: 132,956,973 H291L probably damaging Het
Thbs3 A G 3: 89,216,840 D80G probably damaging Het
Tnxb C T 17: 34,689,420 S1349L probably damaging Het
Toporsl A G 4: 52,611,996 R630G probably benign Het
Vmn1r43 C A 6: 89,869,855 M216I probably benign Het
Wdr17 T A 8: 54,639,876 E1068D probably benign Het
Wnt10a G A 1: 74,803,603 V413I probably damaging Het
Zfp141 T C 7: 42,476,687 probably null Het
Zfp169 T C 13: 48,490,158 I498V probably benign Het
Other mutations in Faim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Faim2 APN 15 99514433 missense probably damaging 1.00
IGL02820:Faim2 APN 15 99521257 missense probably benign 0.02
IGL02989:Faim2 APN 15 99520362 splice site probably benign
R0827:Faim2 UTSW 15 99524736 missense probably benign
R1171:Faim2 UTSW 15 99500254 missense probably benign 0.05
R1678:Faim2 UTSW 15 99520336 missense possibly damaging 0.92
R1785:Faim2 UTSW 15 99512542 missense probably damaging 1.00
R2004:Faim2 UTSW 15 99500246 missense possibly damaging 0.87
R2063:Faim2 UTSW 15 99514433 missense probably damaging 1.00
R3401:Faim2 UTSW 15 99520348 missense probably damaging 0.98
R4242:Faim2 UTSW 15 99500201 missense probably damaging 1.00
R4664:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4664:Faim2 UTSW 15 99524701 missense probably benign
R4665:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4665:Faim2 UTSW 15 99524701 missense probably benign
R4952:Faim2 UTSW 15 99521228 missense possibly damaging 0.51
R5973:Faim2 UTSW 15 99521251 missense probably benign
R7162:Faim2 UTSW 15 99521167 critical splice donor site probably null
R7305:Faim2 UTSW 15 99513933 missense probably damaging 0.99
R7601:Faim2 UTSW 15 99500266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATTCCTTGAAATGGGCTGTTTG -3'
(R):5'- AGGCCAAAGCGCATGTCTTG -3'

Sequencing Primer
(F):5'- TGGTCCTCTTGACATCAGCAAAAG -3'
(R):5'- AGCAGCATCTTCCCAGGC -3'
Posted On2016-05-18