Mutagenetix > Incidental Mutation

Incidental Mutation 'R4701:Kif1a'

386358

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

041949-MU

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Essential gene?

Probably essential (E-score: 0.882) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93078835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 37 (I37V)

Ref Sequence

ENSEMBL: ENSMUSP00000140163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000186861] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000086819
AA Change: I37V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112958
AA Change: I37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171556
AA Change: I37V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171796
AA Change: I37V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186861
AA Change: I37V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141194
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	109	9.7e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188493

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: I37V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: I37V

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Meta Mutation Damage Score

0.0989

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plch1	A	T	3: 63,699,496		probably null	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	93022451	missense	probably benign
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGATCAACTCAGAGTGACCC -3'
(R):5'- TGTGAGTCCATCCCAATGAGAG -3'

Sequencing Primer
(F):5'- GATTAGGGCAGAGTCTTCATCCC -3'
(R):5'- GGGGCAAAGACTCCTGTGTG -3'

Posted On

2016-05-19