Mutagenetix > Incidental Mutations

Incidental Mutation 'R4701:Plch1'

386359

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

041949-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R4701 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 63699496 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably null
Transcript: ENSMUST00000048134

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000059973

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084105

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159374

Predicted Effect

probably null
Transcript: ENSMUST00000159676

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159982

Predicted Effect

probably null
Transcript: ENSMUST00000160638

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162269

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176861

Predicted Effect

probably null
Transcript: ENSMUST00000177143

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

96% (108/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	C	11: 101,411,160	I196V	probably benign	Het
Aass	T	A	6: 23,075,856	K761*	probably null	Het
Abca13	A	G	11: 9,292,306	T1390A	possibly damaging	Het
Abhd16a	T	C	17: 35,096,606		probably null	Het
Acad11	C	T	9: 104,095,565	Q486*	probably null	Het
Actl9	T	C	17: 33,433,935	L323P	probably benign	Het
Adam12	T	A	7: 133,916,462	I650F	possibly damaging	Het
Adgre4	A	T	17: 55,784,971	D77V	probably damaging	Het
Ankrd26	A	G	6: 118,506,485	F1586S	possibly damaging	Het
Anpep	T	C	7: 79,839,465	T320A	probably benign	Het
Arl15	T	A	13: 113,967,725	C133S	probably benign	Het
Ascc3	A	G	10: 50,720,664	N1230S	possibly damaging	Het
Atf4	T	A	15: 80,257,417	I336K	probably damaging	Het
Atp7b	A	T	8: 22,000,121	S1044T	probably benign	Het
Atp8b4	A	G	2: 126,414,293	F249L	probably damaging	Het
AU021092	G	T	16: 5,212,193	N319K	probably benign	Het
Bbs4	A	G	9: 59,323,519	V440A	probably benign	Het
Bpifb4	G	T	2: 153,950,385	G450C	probably damaging	Het
Cadm1	G	A	9: 47,818,822		probably benign	Het
Ccser2	G	A	14: 36,938,697	L500F	probably damaging	Het
Cd22	T	A	7: 30,876,153	I155F	probably damaging	Het
Cdkl4	A	T	17: 80,543,652	V207E	probably damaging	Het
Cfap65	T	C	1: 74,918,908	D947G	probably damaging	Het
Cntn6	T	C	6: 104,804,360	V397A	probably benign	Het
Cpox	T	A	16: 58,677,969	Y388*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dda1	T	A	8: 71,473,810	Y58N	probably damaging	Het
Dennd4a	C	T	9: 64,897,357	T1326I	possibly damaging	Het
Eps8l2	A	T	7: 141,357,260	I338F	probably damaging	Het
Fbxo42	A	G	4: 141,199,809	T467A	probably benign	Het
Flt4	T	C	11: 49,626,808	F319S	possibly damaging	Het
Fmn1	A	T	2: 113,584,071	Y895F	possibly damaging	Het
Gm6887	C	A	7: 42,465,093		noncoding transcript	Het
Grid2	A	G	6: 64,665,915	D887G	probably benign	Het
Grm6	C	T	11: 50,863,010	P714S	probably damaging	Het
Gsto2	A	G	19: 47,884,656	I157V	probably benign	Het
Il15ra	A	G	2: 11,718,345		probably null	Het
Impg1	A	G	9: 80,314,400	F713L	probably benign	Het
Jag1	T	A	2: 137,094,456	T373S	probably benign	Het
Kcnh3	T	A	15: 99,241,945	L904Q	probably benign	Het
Kctd19	C	A	8: 105,390,429	G356V	possibly damaging	Het
Kdm5b	T	A	1: 134,606,012		probably benign	Het
Kif1a	T	C	1: 93,078,835	I37V	probably damaging	Het
Lama5	G	A	2: 180,191,696	R1508C	probably damaging	Het
Lamb1	T	A	12: 31,266,848	C65*	probably null	Het
Lingo1	A	G	9: 56,620,258	F349S	probably damaging	Het
Loxl4	G	A	19: 42,607,613	H147Y	probably benign	Het
Lrrn4cl	T	A	19: 8,852,055	N132K	probably damaging	Het
Med17	A	T	9: 15,270,360	H31Q	probably damaging	Het
Med23	A	T	10: 24,893,648	L476F	probably damaging	Het
Mgst1	A	T	6: 138,150,838	D66V	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Muc4	A	T	16: 32,755,846		probably benign	Het
Myo18a	C	T	11: 77,817,665	T30M	probably damaging	Het
Ncapg2	G	T	12: 116,440,618	R903L	probably benign	Het
Nme1	A	G	11: 93,965,908	I9T	probably damaging	Het
Nmt2	T	A	2: 3,322,641	I357N	probably benign	Het
Nphp4	T	C	4: 152,496,659	F100S	probably damaging	Het
Oca2	C	A	7: 56,255,002	T72K	probably benign	Het
Olfr1411	C	A	1: 92,597,438	D306E	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,062	V105M	probably damaging	Het
Olfr676	A	T	7: 105,035,591	D131V	probably damaging	Het
Olfr677	A	T	7: 105,056,879	D211V	probably damaging	Het
Olfr871	T	C	9: 20,212,625	I92T	probably damaging	Het
Plce1	A	T	19: 38,725,007	T1240S	probably benign	Het
Plxna4	T	C	6: 32,516,688	D331G	probably damaging	Het
Ppp1r3a	T	C	6: 14,718,993	T641A	probably benign	Het
Rab32	A	G	10: 10,550,854	L116P	probably benign	Het
Recql4	C	T	15: 76,708,585	C302Y	probably damaging	Het
Rorc	G	C	3: 94,391,710	E391Q	probably null	Het
Saa4	A	T	7: 46,731,627	F24I	possibly damaging	Het
Sall1	T	A	8: 89,031,160	K772M	probably damaging	Het
Sdk1	T	G	5: 142,185,231	L1950V	probably damaging	Het
Sil1	T	C	18: 35,266,896	E352G	probably benign	Het
Slc26a3	C	T	12: 31,447,774	P59L	probably damaging	Het
Smco2	T	C	6: 146,861,942		probably benign	Het
Sppl3	A	G	5: 115,103,313		probably null	Het
St6gal2	T	A	17: 55,496,344	V360D	probably damaging	Het
Stard9	G	A	2: 120,705,713	R345Q	possibly damaging	Het
Susd4	T	A	1: 182,892,061	Y414N	probably damaging	Het
Tenm4	T	C	7: 96,895,349	Y2191H	probably damaging	Het
Tln2	A	G	9: 67,346,527	V754A	probably benign	Het
Tmem132c	T	A	5: 127,564,496		probably benign	Het
Tnn	A	T	1: 160,147,768	S30T	possibly damaging	Het
Trpd52l3	G	T	19: 30,004,495	V217F	probably damaging	Het
Trpm1	G	T	7: 64,243,500	L1033F	probably damaging	Het
Tulp2	A	G	7: 45,517,924	E182G	probably damaging	Het
Ubr4	A	G	4: 139,471,336	K4490R	possibly damaging	Het
Usp17la	A	T	7: 104,860,649	R154*	probably null	Het
Vmn2r17	T	G	5: 109,427,983	M240R	probably damaging	Het
Vmn2r22	T	A	6: 123,650,469	N56I	probably benign	Het
Wdr66	A	G	5: 123,322,613	K1213E	probably benign	Het
Zdhhc21	A	T	4: 82,820,334	I206N	possibly damaging	Het
Zfp148	T	A	16: 33,456,908	D122E	probably benign	Het
Zfp804a	A	T	2: 82,256,582	S252C	probably damaging	Het
Zgrf1	C	T	3: 127,598,704	T1291I	probably benign	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8206:Plch1	UTSW	3	63702626	splice site	probably null
R8678:Plch1	UTSW	3	63716047	nonsense	probably null
R8731:Plch1	UTSW	3	63697638	missense	probably benign	0.37
R8739:Plch1	UTSW	3	63870685	missense	possibly damaging	0.66
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCCACACTGTTCTGGGTTTG -3'
(R):5'- CGCAAGGTAATCCTCACCTTG -3'

Sequencing Primer
(F):5'- ACACTGTTCTGGGTTTGATACAC -3'
(R):5'- GGTAATCCTCACCTTGAAAGCATAG -3'

Posted On

2016-05-19