Incidental Mutation 'R0426:Tmem209'
Institutional Source Beutler Lab
Gene Symbol Tmem209
Ensembl Gene ENSMUSG00000029782
Gene Nametransmembrane protein 209
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosomal Location30479053-30509783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30491182 bp
Amino Acid Change Leucine to Phenylalanine at position 259 (L259F)
Ref Sequence ENSEMBL: ENSMUSP00000152560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000138823] [ENSMUST00000151187] [ENSMUST00000222934]
Predicted Effect probably benign
Transcript: ENSMUST00000064330
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782

Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102991
AA Change: L375F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782
AA Change: L375F

Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115157
AA Change: L416F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782
AA Change: L416F

Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115160
AA Change: L417F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782
AA Change: L417F

Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138823
AA Change: L417F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782
AA Change: L417F

Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151187
AA Change: L259F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782
AA Change: L259F

Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202269
Predicted Effect probably damaging
Transcript: ENSMUST00000222934
AA Change: L259F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Tmem209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Tmem209 APN 6 30487417 missense probably damaging 0.99
IGL01068:Tmem209 APN 6 30502086 missense probably benign 0.18
IGL02106:Tmem209 APN 6 30508660 splice site probably null
IGL02109:Tmem209 APN 6 30497945 missense probably damaging 1.00
IGL02250:Tmem209 APN 6 30487388 missense probably damaging 1.00
R0012:Tmem209 UTSW 6 30502113 splice site probably benign
R0452:Tmem209 UTSW 6 30487381 missense probably damaging 1.00
R0557:Tmem209 UTSW 6 30501914 missense probably damaging 0.99
R0690:Tmem209 UTSW 6 30505834 missense probably null 1.00
R1202:Tmem209 UTSW 6 30508790 missense probably benign 0.01
R1697:Tmem209 UTSW 6 30497868 missense probably benign 0.00
R3821:Tmem209 UTSW 6 30505960 missense probably damaging 1.00
R4795:Tmem209 UTSW 6 30501955 missense probably benign 0.00
R5131:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R5715:Tmem209 UTSW 6 30497923 nonsense probably null
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6153:Tmem209 UTSW 6 30505795 missense probably benign 0.01
R6181:Tmem209 UTSW 6 30505971 missense probably damaging 1.00
R6256:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R6721:Tmem209 UTSW 6 30497175 missense probably benign 0.00
R6873:Tmem209 UTSW 6 30508456 missense probably damaging 1.00
R7062:Tmem209 UTSW 6 30502017 missense probably damaging 1.00
R7341:Tmem209 UTSW 6 30494795 missense probably benign 0.00
R7461:Tmem209 UTSW 6 30508470 nonsense probably null
R7790:Tmem209 UTSW 6 30497855 missense probably damaging 1.00
R8354:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8454:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8527:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
R8542:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
RF020:Tmem209 UTSW 6 30487418 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtttccttgttcatccttttctttc -3'
Posted On2013-05-23