Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Csf1'

386380

Institutional Source

Beutler Lab

Gene Symbol

Csf1

Ensembl Gene

ENSMUSG00000014599

Gene Name

colony stimulating factor 1 (macrophage)

Synonyms

colony-stimulating factor-1, CSF-1, Csfm, M-CSF

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.674) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107741048-107760469 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107756739 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 38 (T38S)

Ref Sequence

ENSEMBL: ENSMUSP00000115480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000153114]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014743
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: T14S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118593
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599
AA Change: T14S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	257	9.5e-123	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120243
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: T14S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000153114
AA Change: T38S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599
AA Change: T38S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	26	182	1.1e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155557

Meta Mutation Damage Score

0.3270

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Csf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Csf1	APN	3	107756727	missense	probably benign	0.00
IGL00907:Csf1	APN	3	107750346	missense	probably damaging	1.00
IGL01644:Csf1	APN	3	107753842	missense	possibly damaging	0.84
R0022:Csf1	UTSW	3	107753862	missense	probably damaging	0.99
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0350:Csf1	UTSW	3	107748606	missense	probably benign	0.01
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1531:Csf1	UTSW	3	107748338	missense	possibly damaging	0.72
R1897:Csf1	UTSW	3	107748279	missense	probably damaging	1.00
R4375:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4376:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4377:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4469:Csf1	UTSW	3	107750681	critical splice donor site	probably null
R4474:Csf1	UTSW	3	107753856	missense	probably damaging	0.98
R4604:Csf1	UTSW	3	107756962	intron	probably null
R4634:Csf1	UTSW	3	107749167	missense	probably damaging	0.96
R5086:Csf1	UTSW	3	107748710	missense	possibly damaging	0.72
R5156:Csf1	UTSW	3	107748936	missense	probably benign	0.01
R5425:Csf1	UTSW	3	107748896	missense	possibly damaging	0.96
R6120:Csf1	UTSW	3	107753854	missense	probably damaging	0.96
R6268:Csf1	UTSW	3	107747157	missense	possibly damaging	0.86
R6269:Csf1	UTSW	3	107749001	missense	probably benign	0.04
R6273:Csf1	UTSW	3	107749163	missense	probably damaging	1.00
R6298:Csf1	UTSW	3	107748359	missense	possibly damaging	0.96
R7196:Csf1	UTSW	3	107753898	missense	possibly damaging	0.91
R7375:Csf1	UTSW	3	107748179	missense	possibly damaging	0.96
R7437:Csf1	UTSW	3	107750756	missense	probably benign	0.00
R7464:Csf1	UTSW	3	107748875	missense	probably benign	0.03
R7780:Csf1	UTSW	3	107750393	missense	probably damaging	0.96
R7808:Csf1	UTSW	3	107760045	missense	possibly damaging	0.70
Z1177:Csf1	UTSW	3	107749080	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TGGAAGCCTCTCTTTGACTCTG -3'
(R):5'- GCTCTGGGTTAACCTCAGAAG -3'

Sequencing Primer
(F):5'- TCTTTGACTCTGCCTTCTGG -3'
(R):5'- CTCTGGGTTAACCTCAGAAGAGTTC -3'

Posted On

2016-05-20