Mutagenetix > Incidental Mutation

Incidental Mutation 'R4592:Arhgap40'

386393

Institutional Source

Beutler Lab

Gene Symbol

Arhgap40

Ensembl Gene

ENSMUSG00000074625

Gene Name

Rho GTPase activating protein 40

Synonyms

Gm14203

MMRRC Submission

041808-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.490) question?

Stock #

R4592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158512796-158550762 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 158546709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 521 (V521A)

Ref Sequence

ENSEMBL: ENSMUSP00000130349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099133] [ENSMUST00000165398]

AlphaFold

E9Q6X9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099133
AA Change: V524A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096736
Gene: ENSMUSG00000074625
AA Change: V524A

Domain	Start	End	E-Value	Type
low complexity region	123	143	N/A	INTRINSIC
RhoGAP	340	519	1.84e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135838

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165398
AA Change: V521A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130349
Gene: ENSMUSG00000074625
AA Change: V521A

Domain	Start	End	E-Value	Type
low complexity region	120	140	N/A	INTRINSIC
RhoGAP	337	516	1.84e-47	SMART

Meta Mutation Damage Score

0.4632

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Ltbp4	A	C	7: 27,325,183	V674G	probably damaging	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pax8	T	A	2: 24,443,189		probably benign	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rptor	A	G	11: 119,798,840	D321G	probably null	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Triobp	C	T	15: 78,967,095	A483V	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Arhgap40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Arhgap40	APN	2	158531158	missense	probably benign	0.41
IGL00547:Arhgap40	APN	2	158538626	splice site	probably benign
IGL00911:Arhgap40	APN	2	158534716	splice site	probably benign
IGL01084:Arhgap40	APN	2	158543218	missense	probably damaging	1.00
IGL02037:Arhgap40	APN	2	158534822	missense	probably damaging	1.00
IGL02111:Arhgap40	APN	2	158539844	missense	probably damaging	0.99
IGL02131:Arhgap40	APN	2	158531939	splice site	probably null
IGL02552:Arhgap40	APN	2	158546801	missense	probably benign
PIT4305001:Arhgap40	UTSW	2	158531905	missense	probably benign	0.00
R0212:Arhgap40	UTSW	2	158550575	missense	probably damaging	1.00
R0508:Arhgap40	UTSW	2	158546750	missense	probably damaging	1.00
R0787:Arhgap40	UTSW	2	158547790	missense	probably benign
R1075:Arhgap40	UTSW	2	158549647	missense	possibly damaging	0.54
R1201:Arhgap40	UTSW	2	158534769	missense	probably damaging	1.00
R1511:Arhgap40	UTSW	2	158527161	missense	probably benign
R1519:Arhgap40	UTSW	2	158546801	missense	probably benign
R1567:Arhgap40	UTSW	2	158546799	missense	probably damaging	1.00
R1662:Arhgap40	UTSW	2	158539270	missense	probably damaging	1.00
R4120:Arhgap40	UTSW	2	158532330	missense	probably benign	0.02
R4678:Arhgap40	UTSW	2	158532306	missense	probably benign	0.01
R4818:Arhgap40	UTSW	2	158539719	missense	probably damaging	1.00
R4953:Arhgap40	UTSW	2	158543406	missense	possibly damaging	0.57
R5108:Arhgap40	UTSW	2	158547679	missense	probably damaging	1.00
R5578:Arhgap40	UTSW	2	158531206	missense	probably damaging	0.99
R6924:Arhgap40	UTSW	2	158527146	missense	probably benign	0.00
R6931:Arhgap40	UTSW	2	158531218	missense	probably benign	0.00
R7028:Arhgap40	UTSW	2	158531374	critical splice donor site	probably null
R7253:Arhgap40	UTSW	2	158547656	missense	probably benign
R7385:Arhgap40	UTSW	2	158543227	missense	probably damaging	1.00
R7670:Arhgap40	UTSW	2	158531925	missense	probably benign	0.03
R7813:Arhgap40	UTSW	2	158538700	missense	probably benign	0.00
R7824:Arhgap40	UTSW	2	158534746	missense	probably damaging	1.00
R8179:Arhgap40	UTSW	2	158539856	missense	probably damaging	1.00
R8559:Arhgap40	UTSW	2	158541801	missense	probably damaging	1.00
R8799:Arhgap40	UTSW	2	158512838	missense	probably benign	0.33
R8804:Arhgap40	UTSW	2	158547706	missense	probably benign	0.00
R9096:Arhgap40	UTSW	2	158547664	missense	probably benign	0.01
R9097:Arhgap40	UTSW	2	158547664	missense	probably benign	0.01
R9222:Arhgap40	UTSW	2	158546772	missense	probably damaging	1.00
R9488:Arhgap40	UTSW	2	158549651	missense	possibly damaging	0.78
Z1176:Arhgap40	UTSW	2	158534885	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGTGCCAGTGAGAAGCTTC -3'
(R):5'- TCTCCATTCGCCTGGTATGG -3'

Sequencing Primer
(F):5'- AGCACAGCTCTGTCCAGTAG -3'
(R):5'- TGGTATGGGAGCCACTCAC -3'

Posted On

2016-05-24