Incidental Mutation 'R4384:Mdm2'
ID386397
Institutional Source Beutler Lab
Gene Symbol Mdm2
Ensembl Gene ENSMUSG00000020184
Gene Nametransformed mouse 3T3 cell double minute 2
SynonymsMdm-2, 1700007J15Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score218
Status Validated
Chromosome10
Chromosomal Location117688875-117710758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117696439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 114 (D114G)
Ref Sequence ENSEMBL: ENSMUSP00000137039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020408] [ENSMUST00000105263] [ENSMUST00000155285]
Predicted Effect probably benign
Transcript: ENSMUST00000020408
AA Change: D114G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020408
Gene: ENSMUSG00000020184
AA Change: D114G

DomainStartEndE-ValueType
Pfam:SWIB 26 101 1.3e-11 PFAM
low complexity region 145 166 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:zf-RanBP 297 326 1.7e-10 PFAM
low complexity region 390 410 N/A INTRINSIC
RING 436 476 2.42e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105263
AA Change: D65G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100898
Gene: ENSMUSG00000020184
AA Change: D65G

DomainStartEndE-ValueType
Pfam:SWIB 1 53 5e-15 PFAM
low complexity region 96 117 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
Pfam:zf-RanBP 248 277 5.7e-10 PFAM
low complexity region 341 361 N/A INTRINSIC
RING 387 427 2.42e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137102
Predicted Effect possibly damaging
Transcript: ENSMUST00000155285
AA Change: D114G

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137039
Gene: ENSMUSG00000020184
AA Change: D114G

DomainStartEndE-ValueType
Pfam:SWIB 27 102 3.1e-22 PFAM
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice homozygous for a null allele exhibit prenatal lethality. Mice homozygous for one knock-in allele exhibit embryonic lethality while mice homozygous for a different knock-in allele exhibit alters cell cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Mdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Mdm2 APN 10 117702299 missense possibly damaging 0.91
IGL02102:Mdm2 APN 10 117692717 missense possibly damaging 0.93
Xi-an UTSW 10 117709789 splice site probably null
PIT1430001:Mdm2 UTSW 10 117694935 missense probably damaging 1.00
R0322:Mdm2 UTSW 10 117702204 missense possibly damaging 0.78
R1589:Mdm2 UTSW 10 117690529 missense probably benign 0.01
R1766:Mdm2 UTSW 10 117696022 missense probably damaging 1.00
R3153:Mdm2 UTSW 10 117709713 missense possibly damaging 0.90
R4411:Mdm2 UTSW 10 117709789 splice site probably null
R5111:Mdm2 UTSW 10 117691221 missense possibly damaging 0.94
R5509:Mdm2 UTSW 10 117690612 missense probably damaging 1.00
R5578:Mdm2 UTSW 10 117702287 missense possibly damaging 0.81
R5727:Mdm2 UTSW 10 117702307 missense possibly damaging 0.77
R6382:Mdm2 UTSW 10 117692721 missense probably benign 0.31
R7506:Mdm2 UTSW 10 117690691 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCTCCCAATTTTCAAGAACTATG -3'
(R):5'- TTCAGCGTAGGCGATTCCAG -3'

Sequencing Primer
(F):5'- AAGAAGACCATGTGCTGTTCTTGC -3'
(R):5'- AGGCGATTCCAGAATCTGTC -3'
Posted On2016-05-24