Incidental Mutation 'R4384:Luc7l'
ID386399
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene NameLuc7-like
Synonyms
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26252910-26285504 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26279962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000152107] [ENSMUST00000154235]
Predicted Effect unknown
Transcript: ENSMUST00000025023
AA Change: S270P
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188
AA Change: S270P

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114976
AA Change: S270P
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188
AA Change: S270P

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119928
AA Change: S270P
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188
AA Change: S270P

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect probably benign
Transcript: ENSMUST00000140427
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect unknown
Transcript: ENSMUST00000152107
AA Change: S69P
SMART Domains Protein: ENSMUSP00000119717
Gene: ENSMUSG00000024188
AA Change: S69P

DomainStartEndE-ValueType
coiled coil region 8 55 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Meta Mutation Damage Score 0.1780 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1114:Luc7l UTSW 17 26275858 splice site probably benign
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2112:Luc7l UTSW 17 26255127 critical splice donor site probably null
R2286:Luc7l UTSW 17 26280046 utr 3 prime probably benign
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4319:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R5160:Luc7l UTSW 17 26267297 missense probably benign 0.27
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7418:Luc7l UTSW 17 26253182 unclassified probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
R8077:Luc7l UTSW 17 26255073 missense probably damaging 1.00
R8203:Luc7l UTSW 17 26266359 missense possibly damaging 0.95
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Z1177:Luc7l UTSW 17 26281661 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTCAGGGGAAAGATACGGCC -3'
(R):5'- AGACAAAGGGCTCACTCCTG -3'

Sequencing Primer
(F):5'- GCCTTCCGATTAATTCAGGGGAC -3'
(R):5'- AAGGGCTCACTCCTGGTTGAAG -3'
Posted On2016-05-24