Incidental Mutation 'R4624:Helz2'
ID386404
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181239308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 436 (E436G)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: E436G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: E436G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: E436G

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: E436G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: E436G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: E436G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cdh19 T C 1: 110,932,251 K167E probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Fer1l6 T C 15: 58,553,705 I144T probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Hfe A T 13: 23,706,078 C149* probably null Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lilrb4a A G 10: 51,491,488 Y42C probably damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Olfr1436 C T 19: 12,298,983 V50I probably benign Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATAGAGTGAGGGTGCCAC -3'
(R):5'- CGCAGCAGCAAAGAAGTATC -3'

Sequencing Primer
(F):5'- TGCTATCACTGTGGAGGAGAC -3'
(R):5'- ATCAGTGGTAAGTGGAGACTTG -3'
Posted On2016-05-24