Incidental Mutation 'R4614:Jakmip2'
ID 386408
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock # R4614 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43562592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 539 (D539V)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: D539V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: D539V

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Meta Mutation Damage Score 0.3781 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CCACTGAGCTGATGGTGATG -3'
(R):5'- GGACTATTTTGTTTTCCTGGCAAC -3'

Sequencing Primer
(F):5'- TGCAGTTGAGCACGCAG -3'
(R):5'- CAGAGTCTTTGAAAAAGCTGCTG -3'
Posted On 2016-05-25