Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Map4k3'

386413

Institutional Source

Beutler Lab

Gene Symbol

Map4k3

Ensembl Gene

ENSMUSG00000024242

Gene Name

mitogen-activated protein kinase kinase kinase kinase 3

Synonyms

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80580512-80728093 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 80597551 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]

Predicted Effect

probably null
Transcript: ENSMUST00000025089

SMART Domains

Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242

Domain	Start	End	E-Value	Type
S_TKc	16	273	9.71e-95	SMART
low complexity region	299	304	N/A	INTRINSIC
low complexity region	413	421	N/A	INTRINSIC
low complexity region	428	440	N/A	INTRINSIC
low complexity region	467	491	N/A	INTRINSIC
CNH	561	874	2e-115	SMART

Predicted Effect

silent
Transcript: ENSMUST00000112389

SMART Domains

Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242

Domain	Start	End	E-Value	Type
S_TKc	16	273	9.71e-95	SMART
low complexity region	299	304	N/A	INTRINSIC
low complexity region	413	421	N/A	INTRINSIC
low complexity region	428	440	N/A	INTRINSIC
low complexity region	467	491	N/A	INTRINSIC
CNH	561	876	1.39e-114	SMART

Meta Mutation Damage Score

0.9499

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gramd4	T	C	15: 86,134,893	S581P	probably damaging	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Pdzd8	T	C	19: 59,300,128	T947A	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Tgfbrap1	T	C	1: 43,056,706	D524G	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Map4k3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01147:Map4k3	APN	17	80636718	critical splice donor site	probably null
IGL01329:Map4k3	APN	17	80644184	missense	probably benign
IGL01626:Map4k3	APN	17	80605809	missense	probably damaging	0.97
IGL01896:Map4k3	APN	17	80613931	missense	probably benign	0.13
IGL02021:Map4k3	APN	17	80609826	missense	probably damaging	1.00
IGL02585:Map4k3	APN	17	80653919	splice site	probably benign
IGL03101:Map4k3	APN	17	80655855	critical splice donor site	probably null
IGL03231:Map4k3	APN	17	80597675	missense	probably damaging	1.00
IGL03267:Map4k3	APN	17	80664028	missense	probably damaging	1.00
maple_forest	UTSW	17	80603998	missense	probably benign	0.38
R0084:Map4k3	UTSW	17	80655914	missense	possibly damaging	0.91
R0211:Map4k3	UTSW	17	80644841	missense	probably damaging	1.00
R0211:Map4k3	UTSW	17	80644841	missense	probably damaging	1.00
R0612:Map4k3	UTSW	17	80602193	missense	probably damaging	1.00
R0842:Map4k3	UTSW	17	80605983	missense	probably benign	0.35
R2009:Map4k3	UTSW	17	80664088	splice site	probably benign
R2224:Map4k3	UTSW	17	80630454	missense	probably benign	0.00
R3851:Map4k3	UTSW	17	80644323	splice site	probably benign
R4049:Map4k3	UTSW	17	80605965	missense	probably benign	0.10
R4151:Map4k3	UTSW	17	80644534	missense	probably damaging	1.00
R4405:Map4k3	UTSW	17	80615015	critical splice donor site	probably null
R4450:Map4k3	UTSW	17	80603982	critical splice donor site	probably null
R4970:Map4k3	UTSW	17	80653903	missense	probably benign	0.00
R5230:Map4k3	UTSW	17	80615170	missense	probably benign	0.00
R5459:Map4k3	UTSW	17	80609787	missense	probably damaging	1.00
R5568:Map4k3	UTSW	17	80663998	missense	possibly damaging	0.96
R5635:Map4k3	UTSW	17	80613495	missense	possibly damaging	0.94
R5827:Map4k3	UTSW	17	80593283	critical splice donor site	probably null
R5927:Map4k3	UTSW	17	80613919	missense	probably benign	0.06
R5951:Map4k3	UTSW	17	80603998	missense	probably benign	0.38
R5964:Map4k3	UTSW	17	80644762	missense	probably damaging	1.00
R6849:Map4k3	UTSW	17	80630413	critical splice donor site	probably null
R6985:Map4k3	UTSW	17	80636732	missense	probably damaging	1.00
R7040:Map4k3	UTSW	17	80680915	missense	probably damaging	0.98
R7233:Map4k3	UTSW	17	80597648	missense	possibly damaging	0.80
R7511:Map4k3	UTSW	17	80597648	missense	possibly damaging	0.80
R7672:Map4k3	UTSW	17	80615071	missense	possibly damaging	0.58
R7680:Map4k3	UTSW	17	80581876	missense	probably benign	0.02
R7804:Map4k3	UTSW	17	80615070	missense	probably damaging	0.98
R8170:Map4k3	UTSW	17	80605860	missense	possibly damaging	0.88
R8397:Map4k3	UTSW	17	80664017	missense	probably damaging	1.00
R8745:Map4k3	UTSW	17	80636735	missense	possibly damaging	0.85
X0023:Map4k3	UTSW	17	80593091	missense	probably benign
Z1176:Map4k3	UTSW	17	80618337	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GACAGTGTTTGAAACCATGAGAC -3'
(R):5'- AGAGTTTCCTATGCCGTGTCC -3'

Sequencing Primer
(F):5'- TAGTGGGAAACTCTAGCAGCTACATC -3'
(R):5'- CCACTCCGGATGTTTGAGATGC -3'

Posted On

2016-05-26