Mutagenetix > Incidental Mutation

Incidental Mutation 'R4289:Cyp4v3'

386414

Institutional Source

Beutler Lab

Gene Symbol

Cyp4v3

Ensembl Gene

ENSMUSG00000079057

Gene Name

cytochrome P450, family 4, subfamily v, polypeptide 3

Synonyms

MMRRC Submission

041654-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4289 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45304944-45333216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45328223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 73 (F73V)

Ref Sequence

ENSEMBL: ENSMUSP00000092966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095328]

AlphaFold

Q9DBW0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095328
AA Change: F73V

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: F73V

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:p450	51	517	2.7e-123	PFAM

Meta Mutation Damage Score

0.1016

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810022K09Rik	T	C	3: 14,609,654	M1V	probably null	Het
Actl6a	C	T	3: 32,712,114	T39M	possibly damaging	Het
Arhgdib	T	C	6: 136,924,158	N191S	probably benign	Het
Arhgef39	A	G	4: 43,497,353		probably benign	Het
Baz1a	G	A	12: 54,900,448	R1139C	probably damaging	Het
Cdhr5	A	T	7: 141,272,839	I78N	probably damaging	Het
Cfap97	T	A	8: 46,192,661	N525K	probably benign	Het
Cntn2	T	A	1: 132,527,743	Y252F	probably benign	Het
Cyp3a57	G	A	5: 145,349,397	G48S	probably damaging	Het
D3Ertd254e	A	G	3: 36,159,598	N27S	possibly damaging	Het
Ear10	T	C	14: 43,922,947	D141G	probably benign	Het
Fbn2	T	C	18: 58,035,339	I2309V	probably damaging	Het
Fcrl5	A	G	3: 87,442,224	D102G	probably benign	Het
Fdxacb1	A	T	9: 50,772,579	Q614L	probably damaging	Het
Gm10267	T	C	18: 44,157,264	T59A	probably damaging	Het
Gm5581	C	T	6: 131,167,556		noncoding transcript	Het
Gm5592	G	T	7: 41,158,912		probably benign	Het
Gtf2a1l	A	G	17: 88,694,456	T200A	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ift122	T	C	6: 115,923,891	C1057R	probably damaging	Het
Kirrel3	A	T	9: 35,023,473	N73I	probably benign	Het
Kndc1	A	G	7: 139,910,882	I433M	probably benign	Het
Mks1	T	C	11: 87,856,704		probably benign	Het
Mmp14	A	T	14: 54,436,208	K110*	probably null	Het
Mms19	A	G	19: 41,945,553	L938P	probably damaging	Het
Mrpl36	A	T	13: 73,331,658		probably null	Het
Mypn	T	C	10: 63,131,182	E905G	probably damaging	Het
Ncam1	G	T	9: 49,557,172	T329N	probably damaging	Het
Nfkbie	T	C	17: 45,558,590	L157P	probably damaging	Het
Olfr1317	T	A	2: 112,141,974	S10T	probably benign	Het
Olfr297	T	A	7: 86,527,054	I99N	probably damaging	Het
Pappa	C	T	4: 65,155,863	A218V	probably benign	Het
Plekhg5	T	C	4: 152,112,427	Y737H	probably benign	Het
Plod2	G	A	9: 92,602,988	R514Q	possibly damaging	Het
Plxnb1	C	T	9: 109,114,352	R1888W	probably damaging	Het
Prss45	A	G	9: 110,840,929	T269A	probably benign	Het
Ptpn13	A	G	5: 103,533,285	T784A	probably damaging	Het
Pycrl	T	C	15: 75,918,806	N68S	probably benign	Het
Rdh14	A	T	12: 10,394,949	N267Y	probably benign	Het
Rph3a	G	A	5: 120,973,305	R71C	probably damaging	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Spata13	T	A	14: 60,691,074	V27E	probably damaging	Het
Tbc1d1	T	A	5: 64,260,428	S312T	probably damaging	Het
Tcp11l2	T	C	10: 84,605,073		probably null	Het
Trdn	C	T	10: 33,464,582	S604L	probably benign	Het
Ttn	T	C	2: 76,810,398	T13669A	probably benign	Het
Tyw3	A	T	3: 154,597,008	F30I	probably damaging	Het
Vmn1r227	G	T	17: 20,735,830		noncoding transcript	Het
Vmn2r74	C	T	7: 85,957,354	M261I	probably benign	Het
Zfp217	C	T	2: 170,114,787	G764S	probably benign	Het
Zfp748	T	A	13: 67,541,083	H686L	probably damaging	Het

Other mutations in Cyp4v3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Cyp4v3	APN	8	45307003	missense	probably benign	0.04
IGL00503:Cyp4v3	APN	8	45307021	missense	probably damaging	0.98
IGL00757:Cyp4v3	APN	8	45320615	missense	probably damaging	0.98
IGL02375:Cyp4v3	APN	8	45308374	splice site	probably null
IGL02565:Cyp4v3	APN	8	45320637	missense	possibly damaging	0.63
IGL02881:Cyp4v3	APN	8	45308716	missense	probably damaging	1.00
R0745:Cyp4v3	UTSW	8	45308651	unclassified	probably benign
R1818:Cyp4v3	UTSW	8	45315636	missense	possibly damaging	0.77
R1819:Cyp4v3	UTSW	8	45315636	missense	possibly damaging	0.77
R1902:Cyp4v3	UTSW	8	45306952	missense	probably benign	0.00
R2426:Cyp4v3	UTSW	8	45317776	missense	probably benign
R3747:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R3748:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R3750:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R4569:Cyp4v3	UTSW	8	45306992	missense	probably damaging	1.00
R4960:Cyp4v3	UTSW	8	45320637	missense	possibly damaging	0.63
R5260:Cyp4v3	UTSW	8	45306980	missense	probably damaging	1.00
R5479:Cyp4v3	UTSW	8	45310206	missense	probably benign	0.00
R5667:Cyp4v3	UTSW	8	45308535	missense	possibly damaging	0.94
R5940:Cyp4v3	UTSW	8	45321784	missense	probably damaging	1.00
R6102:Cyp4v3	UTSW	8	45320160	missense	probably damaging	1.00
R6470:Cyp4v3	UTSW	8	45317736	nonsense	probably null
R6592:Cyp4v3	UTSW	8	45306981	missense	probably benign	0.02
R6700:Cyp4v3	UTSW	8	45307093	missense	probably damaging	1.00
R7027:Cyp4v3	UTSW	8	45310252	missense	possibly damaging	0.93
R7341:Cyp4v3	UTSW	8	45321750	missense	probably benign	0.01
R7966:Cyp4v3	UTSW	8	45332917	missense	probably benign	0.44
R8331:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R8886:Cyp4v3	UTSW	8	45321748	nonsense	probably null
R8955:Cyp4v3	UTSW	8	45308527	missense	probably benign	0.00
R8957:Cyp4v3	UTSW	8	45306981	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACAATGCCTCATGAATGTAATGCTC -3'
(R):5'- GAATGTTGTCCACCTCCTGTG -3'

Sequencing Primer
(F):5'- CCTCATGAATGTAATGCTCTTTGAAG -3'
(R):5'- GTGAGCTCACACCCCCTC -3'

Posted On

2016-05-26