Incidental Mutation 'R4654:Cnp'
ID386418
Institutional Source Beutler Lab
Gene Symbol Cnp
Ensembl Gene ENSMUSG00000006782
Gene Name2',3'-cyclic nucleotide 3' phosphodiesterase
SynonymsCNPase, Cnp-1, Cnp1
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100574904-100591729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100579051 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 271 (E271G)
Ref Sequence ENSEMBL: ENSMUSP00000099409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000103120]
PDB Structure
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with sulfate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic NADP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with GTP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic AMP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3-(SP)-Cyclic-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3'- cyclic AMP [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000014339
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103120
AA Change: E271G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782
AA Change: E271G

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150414
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in ataxia, gait abnormalities, hindlimb paralysis, muscle weakness, convulsive seizures, weight loss, kyphosis, reactive gliosis, axonal swellings and degeneration, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in Cnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Cnp APN 11 100576699 missense probably benign 0.25
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0015:Cnp UTSW 11 100578908 splice site probably null
R0015:Cnp UTSW 11 100578908 splice site probably null
R0546:Cnp UTSW 11 100580723 missense probably damaging 1.00
R2384:Cnp UTSW 11 100576453 missense probably damaging 1.00
R4653:Cnp UTSW 11 100576516 missense probably benign 0.19
R4898:Cnp UTSW 11 100576376 missense probably benign 0.11
R5559:Cnp UTSW 11 100576417 missense probably damaging 1.00
R7045:Cnp UTSW 11 100580358 missense probably benign 0.00
R7225:Cnp UTSW 11 100580587 nonsense probably null
R7776:Cnp UTSW 11 100578988 missense probably damaging 1.00
R8350:Cnp UTSW 11 100576441 missense probably damaging 1.00
R8450:Cnp UTSW 11 100576441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCTCCGAGATAGGTGTTGG -3'
(R):5'- CTGCTGCCTGGCATAAATCC -3'

Sequencing Primer
(F):5'- TGTTGGTAGGCCCAGCTC -3'
(R):5'- TGCTGCCTGGCATAAATCCATAAATC -3'
Posted On2016-05-26