Incidental Mutation 'R4480:Rab35'
ID386422
Institutional Source Beutler Lab
Gene Symbol Rab35
Ensembl Gene ENSMUSG00000029518
Gene NameRAB35, member RAS oncogene family
SynonymsRAB1C, 9530019H02Rik, H-ray
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115631908-115647736 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 115637764 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 34 (S34*)
Ref Sequence ENSEMBL: ENSMUSP00000138402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031492] [ENSMUST00000138885]
Predicted Effect probably null
Transcript: ENSMUST00000031492
AA Change: S34*
SMART Domains Protein: ENSMUSP00000031492
Gene: ENSMUSG00000029518
AA Change: S34*

DomainStartEndE-ValueType
RAB 9 171 5.07e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138885
AA Change: S34*
SMART Domains Protein: ENSMUSP00000138402
Gene: ENSMUSG00000029518
AA Change: S34*

DomainStartEndE-ValueType
Pfam:Ras 10 42 1e-8 PFAM
Pfam:Miro 10 46 7.5e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Rab35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0502:Rab35 UTSW 5 115645664 missense probably benign 0.02
R1858:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R1879:Rab35 UTSW 5 115640160 missense probably damaging 1.00
R4824:Rab35 UTSW 5 115643395 missense possibly damaging 0.95
R4937:Rab35 UTSW 5 115640088 missense probably damaging 0.96
R6062:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R6126:Rab35 UTSW 5 115645708 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGAGCAGCTTGTCTTAC -3'
(R):5'- AGCAGAGGCCTTTTGTGAAGAG -3'

Sequencing Primer
(F):5'- GAGCAGCTTGTCTTACATGAGAC -3'
(R):5'- CCTTTTGTGAAGAGATGGACCAAGC -3'
Posted On2016-05-26