Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Gstm1'

386438

Institutional Source

Beutler Lab

Gene Symbol

Gstm1

Ensembl Gene

ENSMUSG00000058135

Gene Name

glutathione S-transferase, mu 1

Synonyms

Gstb1, Gstb-1

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107919571-107925289 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 107923834 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000126593] [ENSMUST00000153314] [ENSMUST00000153314]

AlphaFold

P10649

Predicted Effect

probably null
Transcript: ENSMUST00000004140

SMART Domains

Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	1.3e-20	PFAM
Pfam:GST_C_3	40	190	5.2e-11	PFAM
Pfam:GST_C	104	192	3.7e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000004140

SMART Domains

Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	1.3e-20	PFAM
Pfam:GST_C_3	40	190	5.2e-11	PFAM
Pfam:GST_C	104	192	3.7e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120197

Predicted Effect

probably null
Transcript: ENSMUST00000126593

SMART Domains

Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	8.3e-24	PFAM
Pfam:GST_C	104	201	6.7e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126593

SMART Domains

Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	8.3e-24	PFAM
Pfam:GST_C	104	201	6.7e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138374

Predicted Effect

probably null
Transcript: ENSMUST00000153314

SMART Domains

Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	1	23	1.7e-7	PFAM
Pfam:GST_C	45	168	1.2e-18	PFAM
Pfam:GST_C_3	92	166	8.3e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000153314

SMART Domains

Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	1	23	1.7e-7	PFAM
Pfam:GST_C	45	168	1.2e-18	PFAM
Pfam:GST_C_3	92	166	8.3e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198532

Meta Mutation Damage Score

0.9588

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,567,349 (GRCm39)	G5275S	probably benign	Het
Akap11	A	G	14: 78,747,699 (GRCm39)	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,511,680 (GRCm39)	V229A	probably damaging	Het
AW112010	A	G	19: 11,027,757 (GRCm39)		noncoding transcript	Het
Ccdc158	A	G	5: 92,781,187 (GRCm39)	S873P	probably benign	Het
Cep350	A	G	1: 155,802,214 (GRCm39)	V1104A	probably benign	Het
Chil4	G	A	3: 106,121,678 (GRCm39)	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,625 (GRCm39)	E155G	probably damaging	Het
Ctsq	T	C	13: 61,186,726 (GRCm39)	I93V	probably benign	Het
Dbi	A	T	1: 120,048,535 (GRCm39)	I37K	probably benign	Het
Defa35	T	C	8: 21,555,208 (GRCm39)	S43P	probably damaging	Het
Fance	T	A	17: 28,534,781 (GRCm39)		probably benign	Het
Fbxl6	A	G	15: 76,422,129 (GRCm39)	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,865,269 (GRCm39)	F346L	probably damaging	Het
Gm11735	C	A	11: 116,632,101 (GRCm39)		noncoding transcript	Het
Gm28042	T	C	2: 119,866,321 (GRCm39)	I373T	possibly damaging	Het
Golga4	T	C	9: 118,343,254 (GRCm39)	S27P	probably damaging	Het
Lama3	T	A	18: 12,682,310 (GRCm39)	I1092K	probably benign	Het
Med15	A	T	16: 17,489,428 (GRCm39)		probably benign	Het
Nlrp6	A	G	7: 140,501,694 (GRCm39)	D87G	probably damaging	Het
Parp11	A	G	6: 127,448,568 (GRCm39)	T62A	probably benign	Het
Pcnt	A	G	10: 76,237,317 (GRCm39)	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 21,176,072 (GRCm39)	T98I	probably benign	Het
Pramel11	T	A	4: 143,622,410 (GRCm39)	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,844,930 (GRCm39)	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,455,104 (GRCm39)	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,748,397 (GRCm39)		noncoding transcript	Het
Tnfaip3	A	T	10: 18,887,375 (GRCm39)	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,714,745 (GRCm39)		probably null	Het
Usp9x	A	G	X: 12,987,687 (GRCm39)	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,412,118 (GRCm39)	V238E	probably damaging	Het
Zfp507	A	G	7: 35,487,141 (GRCm39)		probably null	Het
Zfp532	G	T	18: 65,789,636 (GRCm39)	W1025L	probably benign	Het

Other mutations in Gstm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0335:Gstm1	UTSW	3	107,920,012 (GRCm39)	missense	possibly damaging	0.87
R0458:Gstm1	UTSW	3	107,924,679 (GRCm39)	missense	probably benign	0.01
R0907:Gstm1	UTSW	3	107,924,696 (GRCm39)	missense	probably damaging	1.00
R1069:Gstm1	UTSW	3	107,920,064 (GRCm39)	missense	probably damaging	1.00
R1180:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R1181:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R1998:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R2000:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R4857:Gstm1	UTSW	3	107,923,724 (GRCm39)	missense	possibly damaging	0.67
R5192:Gstm1	UTSW	3	107,922,259 (GRCm39)	critical splice donor site	probably null
R5262:Gstm1	UTSW	3	107,923,679 (GRCm39)	missense	probably benign	0.01
R5356:Gstm1	UTSW	3	107,920,052 (GRCm39)	missense	probably benign	0.00
R5485:Gstm1	UTSW	3	107,924,720 (GRCm39)	missense	probably damaging	1.00
R6323:Gstm1	UTSW	3	107,925,063 (GRCm39)	missense	probably benign	0.44
R7165:Gstm1	UTSW	3	107,923,693 (GRCm39)	missense	probably benign
R7250:Gstm1	UTSW	3	107,923,709 (GRCm39)	missense	probably damaging	0.98
R7638:Gstm1	UTSW	3	107,921,866 (GRCm39)	splice site	probably null
R9656:Gstm1	UTSW	3	107,925,072 (GRCm39)	missense	probably damaging	1.00
R9797:Gstm1	UTSW	3	107,925,080 (GRCm39)	missense	probably benign	0.10
X0023:Gstm1	UTSW	3	107,920,043 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAACAGAGCATGATGAGCTGC -3'
(R):5'- AGCTCTCTCATTCAGTGCACAC -3'

Sequencing Primer
(F):5'- CATGCGGGTGTCCATGAC -3'
(R):5'- TTCCCATGGCAGGCACAC -3'

Posted On

2016-06-01