Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Txlnb'

386439

Institutional Source

Beutler Lab

Gene Symbol

Txlnb

Ensembl Gene

ENSMUSG00000039891

Gene Name

taxilin beta

Synonyms

2310001N14Rik, Mdp77

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R4483 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

17796226-17845665 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to TTA at 17838997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037964]

AlphaFold

Q8VBT1

Predicted Effect

probably null
Transcript: ENSMUST00000037964

SMART Domains

Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891

Domain	Start	End	E-Value	Type
internal_repeat_2	5	22	2.13e-6	PROSPERO
internal_repeat_1	25	93	4.27e-8	PROSPERO
low complexity region	115	128	N/A	INTRINSIC
Pfam:Taxilin	145	454	3.1e-122	PFAM
low complexity region	477	491	N/A	INTRINSIC
internal_repeat_2	543	560	2.13e-6	PROSPERO
low complexity region	575	591	N/A	INTRINSIC
internal_repeat_1	600	659	4.27e-8	PROSPERO

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Txlnb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Txlnb	APN	10	17842963	missense	probably damaging	0.98
IGL01820:Txlnb	APN	10	17806858	critical splice donor site	probably null
IGL02244:Txlnb	APN	10	17843368	missense	probably benign	0.00
IGL02247:Txlnb	APN	10	17830342	missense	possibly damaging	0.55
IGL02247:Txlnb	APN	10	17841528	splice site	probably benign
IGL02931:Txlnb	APN	10	17827982	missense	probably damaging	1.00
IGL03006:Txlnb	APN	10	17838975	missense	probably damaging	0.96
IGL02991:Txlnb	UTSW	10	17841453	missense	probably damaging	1.00
R0092:Txlnb	UTSW	10	17842755	missense	possibly damaging	0.91
R0800:Txlnb	UTSW	10	17799492	missense	possibly damaging	0.50
R0908:Txlnb	UTSW	10	17799177	missense	probably damaging	1.00
R1172:Txlnb	UTSW	10	17842756	missense	probably benign	0.23
R1174:Txlnb	UTSW	10	17842756	missense	probably benign	0.23
R1340:Txlnb	UTSW	10	17842740	missense	probably damaging	1.00
R1373:Txlnb	UTSW	10	17838947	missense	probably damaging	1.00
R1641:Txlnb	UTSW	10	17806773	missense	possibly damaging	0.55
R1680:Txlnb	UTSW	10	17843233	missense	probably benign	0.01
R1710:Txlnb	UTSW	10	17843455	missense	possibly damaging	0.90
R1741:Txlnb	UTSW	10	17838947	missense	probably damaging	1.00
R1955:Txlnb	UTSW	10	17799420	missense	probably damaging	0.98
R2031:Txlnb	UTSW	10	17830314	missense	possibly damaging	0.85
R4300:Txlnb	UTSW	10	17827925	missense	probably damaging	1.00
R4484:Txlnb	UTSW	10	17838997	nonsense	probably null
R4656:Txlnb	UTSW	10	17815276	missense	probably damaging	1.00
R4664:Txlnb	UTSW	10	17843194	missense	probably damaging	0.99
R4723:Txlnb	UTSW	10	17799267	missense	probably benign	0.02
R4974:Txlnb	UTSW	10	17838969	missense	probably damaging	1.00
R5291:Txlnb	UTSW	10	17799396	missense	possibly damaging	0.92
R5538:Txlnb	UTSW	10	17838909	missense	probably damaging	1.00
R5791:Txlnb	UTSW	10	17799128	missense	probably benign	0.01
R5967:Txlnb	UTSW	10	17799420	missense	probably damaging	0.98
R6144:Txlnb	UTSW	10	17843166	missense	probably benign	0.17
R6212:Txlnb	UTSW	10	17799309	missense	probably damaging	1.00
R7146:Txlnb	UTSW	10	17827798	missense	possibly damaging	0.81
R7171:Txlnb	UTSW	10	17842984	missense	probably benign	0.22
R7253:Txlnb	UTSW	10	17827885	missense	probably damaging	1.00
R7468:Txlnb	UTSW	10	17799334	missense	probably damaging	0.96
R7608:Txlnb	UTSW	10	17815398	missense	probably damaging	0.98
R7936:Txlnb	UTSW	10	17827964	missense	probably benign	0.26
R8245:Txlnb	UTSW	10	17841457	missense	probably damaging	1.00
R8262:Txlnb	UTSW	10	17843004	missense	possibly damaging	0.90
R8435:Txlnb	UTSW	10	17827796	missense	probably damaging	1.00
R8933:Txlnb	UTSW	10	17806798	missense	probably damaging	0.97
R9218:Txlnb	UTSW	10	17842822	missense	probably damaging	0.99
R9329:Txlnb	UTSW	10	17806846	missense	probably damaging	1.00
X0025:Txlnb	UTSW	10	17799422	missense	probably benign	0.39
Z1177:Txlnb	UTSW	10	17806806	missense	probably benign	0.33
Z1177:Txlnb	UTSW	10	17827804	missense	probably damaging	1.00
Z1177:Txlnb	UTSW	10	17833308	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GCTAAACATGTGAGTAATCCTGTAC -3'
(R):5'- GGCCATTGATCAGATCTATTTACTGG -3'

Sequencing Primer
(F):5'- CTCAAATAATGAACAGTGACTTGGG -3'
(R):5'- CTGGAGTATCTTAGCCAGAG -3'

Posted On

2016-06-01