Incidental Mutation 'R4697:Sv2c'
ID 386441
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96122526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 417 (I417F)
Ref Sequence ENSEMBL: ENSMUSP00000124473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000161263
AA Change: I417F

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: I417F

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect possibly damaging
Transcript: ENSMUST00000182289
AA Change: I417F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: I417F

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Meta Mutation Damage Score 0.4116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGGAATTCTAGCAAGTTAGC -3'
(R):5'- AAAGTCCGCATTGGCTTTTCAG -3'

Sequencing Primer
(F):5'- CTAGCAAGTTAGCAGAATTGAGTC -3'
(R):5'- CTCTAGCACACATGAGGTTCTAGG -3'
Posted On 2016-06-01