Incidental Mutation 'R4697:Sv2c'
ID386441
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Namesynaptic vesicle glycoprotein 2c
Synonyms4930527L09Rik
MMRRC Submission 041947-MU
Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95954594-96132577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95986018 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 417 (I417F)
Ref Sequence ENSEMBL: ENSMUSP00000124473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161263
AA Change: I417F

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: I417F

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect possibly damaging
Transcript: ENSMUST00000182289
AA Change: I417F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: I417F

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Meta Mutation Damage Score 0.4116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96048429 missense probably damaging 1.00
IGL01313:Sv2c APN 13 96088289 missense probably damaging 1.00
IGL02710:Sv2c APN 13 95989141 missense probably damaging 0.99
IGL02990:Sv2c APN 13 96088378 missense probably damaging 1.00
IGL03145:Sv2c APN 13 95989098 missense probably damaging 1.00
D4043:Sv2c UTSW 13 96088481 missense probably benign 0.27
R0390:Sv2c UTSW 13 96088708 missense probably benign
R0849:Sv2c UTSW 13 95989811 missense probably damaging 1.00
R0907:Sv2c UTSW 13 96088255 missense probably damaging 1.00
R1177:Sv2c UTSW 13 95989763 missense possibly damaging 0.79
R1840:Sv2c UTSW 13 95981844 missense probably benign 0.08
R1865:Sv2c UTSW 13 95976775 missense probably benign 0.29
R1959:Sv2c UTSW 13 95976645 missense probably damaging 1.00
R2440:Sv2c UTSW 13 96048576 missense probably damaging 1.00
R4007:Sv2c UTSW 13 95986833 splice site probably benign
R4197:Sv2c UTSW 13 95978128 missense probably damaging 1.00
R4719:Sv2c UTSW 13 95986811 missense probably benign 0.21
R4822:Sv2c UTSW 13 95985949 missense probably damaging 1.00
R5237:Sv2c UTSW 13 95981883 missense possibly damaging 0.76
R5452:Sv2c UTSW 13 95978083 missense probably damaging 1.00
R5531:Sv2c UTSW 13 95961378 missense probably damaging 0.98
R5756:Sv2c UTSW 13 95985967 missense probably benign
R5982:Sv2c UTSW 13 95976063 nonsense probably null
R6220:Sv2c UTSW 13 95976626 missense probably damaging 1.00
R6511:Sv2c UTSW 13 96048525 missense probably benign 0.00
R6520:Sv2c UTSW 13 95986721 missense probably benign
R7001:Sv2c UTSW 13 95981953 missense probably benign 0.11
R7073:Sv2c UTSW 13 96088250 missense probably damaging 1.00
R7116:Sv2c UTSW 13 95976644 missense probably damaging 1.00
R7261:Sv2c UTSW 13 96088301 missense probably damaging 1.00
R7374:Sv2c UTSW 13 95989136 missense probably damaging 1.00
R7423:Sv2c UTSW 13 96048548 missense probably benign 0.03
R7626:Sv2c UTSW 13 95985943 missense probably benign 0.13
R7727:Sv2c UTSW 13 95976695 missense possibly damaging 0.89
R7767:Sv2c UTSW 13 95989715 missense probably damaging 1.00
R7818:Sv2c UTSW 13 95986820 nonsense probably null
R7831:Sv2c UTSW 13 95976692 missense probably damaging 1.00
R7991:Sv2c UTSW 13 96088289 missense probably damaging 1.00
R8137:Sv2c UTSW 13 96088663 missense probably damaging 0.96
R8254:Sv2c UTSW 13 96088565 missense probably damaging 1.00
Z1176:Sv2c UTSW 13 95976097 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGGAATTCTAGCAAGTTAGC -3'
(R):5'- AAAGTCCGCATTGGCTTTTCAG -3'

Sequencing Primer
(F):5'- CTAGCAAGTTAGCAGAATTGAGTC -3'
(R):5'- CTCTAGCACACATGAGGTTCTAGG -3'
Posted On2016-06-01