Mutagenetix > Incidental Mutation

Incidental Mutation 'R4594:Muc6'

386444

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

041810-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R4594 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

141633456-141655319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141638772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 1996 (T1996N)

Ref Sequence

ENSEMBL: ENSMUSP00000140483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062451
AA Change: T1931N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T1931N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190907
AA Change: T1996N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T1996N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141645902	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141638890	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141648066	nonsense	probably null
IGL01021:Muc6	APN	7	141637162	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141648454	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141646659	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141638614	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141651307	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141650041	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141649804	nonsense	probably null
IGL01810:Muc6	APN	7	141651062	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141639850	intron	probably benign
IGL02192:Muc6	APN	7	141637804	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141649624	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141640575	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141641496	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141640459	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141636940	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141649578	splice site	probably benign
IGL02851:Muc6	APN	7	141648361	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141640147	intron	probably benign
IGL03070:Muc6	APN	7	141644567	splice site	probably benign
IGL03108:Muc6	APN	7	141637489	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141652059	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141648082	missense	probably damaging	1.00
anticipation	UTSW	7	141634450	frame shift	probably null
F5770:Muc6	UTSW	7	141647613	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141634116	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141639559	intron	probably benign
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141636955	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141652283	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141640468	missense	probably benign
R0503:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141638584	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141639559	intron	probably benign
R0880:Muc6	UTSW	7	141637357	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141644233	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141645855	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141640197	intron	probably benign
R1293:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141647909	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141652103	splice site	probably benign
R1548:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1576:Muc6	UTSW	7	141634524	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141647998	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141650487	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141634458	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141637098	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141640062	nonsense	probably null
R1964:Muc6	UTSW	7	141640063	intron	probably benign
R1975:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141634078	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141649810	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141646960	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141637924	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141637531	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141640384	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141637038	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141648681	splice site	probably benign
R3872:Muc6	UTSW	7	141640600	missense	probably benign
R4029:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141648655	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141637663	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141640089	intron	probably benign
R4509:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141644222	missense	probably benign	0.03
R4677:Muc6	UTSW	7	141639790	intron	probably benign
R4678:Muc6	UTSW	7	141644287	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141640159	intron	probably benign
R4737:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4981:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141639559	intron	probably benign
R5012:Muc6	UTSW	7	141636657	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141640528	missense	probably benign
R5027:Muc6	UTSW	7	141636436	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141644224	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141639559	intron	probably benign
R5179:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141651110	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141637923	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141648813	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141636535	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141649585	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141640423	splice site	probably benign
R5808:Muc6	UTSW	7	141640093	intron	probably benign
R5865:Muc6	UTSW	7	141650504	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141641570	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141648374	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141640525	missense	probably benign
R6236:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141648821	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141651115	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141639610	intron	probably benign
R6609:Muc6	UTSW	7	141640433	splice site	probably benign
R6610:Muc6	UTSW	7	141640433	splice site	probably benign
R6611:Muc6	UTSW	7	141640433	splice site	probably benign
R6623:Muc6	UTSW	7	141639559	intron	probably benign
R6626:Muc6	UTSW	7	141639559	intron	probably benign
R6817:Muc6	UTSW	7	141651061	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141637540	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141639979	intron	probably benign
R7001:Muc6	UTSW	7	141637407	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141640189	intron	probably benign
R7097:Muc6	UTSW	7	141634450	frame shift	probably null
R7099:Muc6	UTSW	7	141634450	frame shift	probably null
R7101:Muc6	UTSW	7	141634450	frame shift	probably null
R7107:Muc6	UTSW	7	141634450	frame shift	probably null
R7108:Muc6	UTSW	7	141634450	frame shift	probably null
R7112:Muc6	UTSW	7	141649277	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141634450	frame shift	probably null
R7204:Muc6	UTSW	7	141634450	frame shift	probably null
R7205:Muc6	UTSW	7	141634450	frame shift	probably null
R7222:Muc6	UTSW	7	141634515	missense	unknown
R7230:Muc6	UTSW	7	141649214	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141640575	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141639823	missense	unknown
R7501:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141636541	missense	unknown
R7641:Muc6	UTSW	7	141639825	missense	unknown
R7644:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141648658	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141637060	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141639825	missense	unknown
R7679:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141651057	splice site	probably null
R7806:Muc6	UTSW	7	141637474	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141640371	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141645921	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141645420	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141645481	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141640462	missense	unknown
R8130:Muc6	UTSW	7	141647087	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141649408	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141640528	missense	unknown
R8294:Muc6	UTSW	7	141637350	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141640258	missense	unknown
R8379:Muc6	UTSW	7	141644312	nonsense	probably null
R8537:Muc6	UTSW	7	141647917	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141642172	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141643282	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141647524	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141637105	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141640084	missense	unknown
R9023:Muc6	UTSW	7	141651167	nonsense	probably null
R9058:Muc6	UTSW	7	141638241	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141640471	missense	unknown
R9495:Muc6	UTSW	7	141651133	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141636397	missense	unknown
R9787:Muc6	UTSW	7	141641481	nonsense	probably null
R9788:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141647613	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141647613	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141651699	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141637914	missense	possibly damaging	0.72
Z1177:Muc6	UTSW	7	141650436	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141651391	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TCAGAAGTTGGTGTCACAGAGG -3'
(R):5'- ACCTCCATGCCACTGATGAC -3'

Sequencing Primer
(F):5'- TTGGTGTCACAGAGGAGGTTGAAG -3'
(R):5'- TGTCACGTATACAACCACTGCTG -3'

Posted On

2016-06-01