Mutagenetix > Incidental Mutation

Incidental Mutation 'R0426:Atp10a'

38645

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

038628-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R0426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58784734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 252 (M252T)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

probably benign
Transcript: ENSMUST00000168747
AA Change: M252T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: M252T

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (86/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	C	T	5: 107,510,373	T1603I	probably damaging	Het
Abca8b	G	T	11: 109,955,027		probably benign	Het
Acadl	A	T	1: 66,841,646	F320L	probably damaging	Het
Acsbg1	T	C	9: 54,622,746	D222G	probably benign	Het
Anapc15	A	G	7: 101,898,033	T39A	probably benign	Het
Ano3	A	T	2: 110,661,174	V919E	probably damaging	Het
Arhgef12	T	C	9: 42,970,990		probably null	Het
Atad5	T	A	11: 80,112,832	I1091N	probably benign	Het
Atf1	A	T	15: 100,232,827	H26L	possibly damaging	Het
Cd55	C	T	1: 130,448,372	R347H	probably benign	Het
Cdc27	A	C	11: 104,513,027		probably null	Het
Cdh9	G	A	15: 16,823,454		probably null	Het
Cdk11b	T	C	4: 155,642,512		probably benign	Het
Cep70	A	G	9: 99,297,684	D567G	probably benign	Het
Cep78	A	T	19: 15,970,970	Y382*	probably null	Het
Col9a2	T	C	4: 121,044,660		probably benign	Het
Cyp2d12	G	A	15: 82,558,963	D409N	probably benign	Het
Ddx39	A	G	8: 83,721,769	T217A	probably benign	Het
Dennd1b	T	A	1: 139,170,196	D733E	probably benign	Het
Dicer1	A	G	12: 104,702,542	S1294P	probably damaging	Het
Dnah3	T	C	7: 119,943,572	E3539G	probably benign	Het
Dnmbp	A	G	19: 43,852,436		probably benign	Het
Dysf	T	C	6: 84,149,757	L1332P	probably damaging	Het
F5	A	G	1: 164,182,840	D380G	probably damaging	Het
Fam160a2	A	C	7: 105,389,473	C186W	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Galr2	C	A	11: 116,281,691	A69D	probably damaging	Het
Grk2	T	C	19: 4,290,600		probably null	Het
Gtf3c1	A	T	7: 125,663,016	Y1119*	probably null	Het
Hgd	A	T	16: 37,588,685		probably benign	Het
Ildr2	G	T	1: 166,308,899	V436L	probably benign	Het
Intu	G	A	3: 40,675,305	C355Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,096	P268T	probably benign	Het
Jarid2	T	C	13: 44,840,882		probably null	Het
Jup	A	T	11: 100,372,401	M716K	probably benign	Het
Kank1	G	A	19: 25,411,473	V809I	probably damaging	Het
Kdm1b	T	A	13: 47,064,244		probably benign	Het
Kdm3a	C	T	6: 71,600,755	C687Y	probably damaging	Het
Kdm5d	T	A	Y: 942,437		probably benign	Het
Kifap3	T	A	1: 163,865,552		probably benign	Het
Macf1	T	A	4: 123,483,660	K1400*	probably null	Het
Majin	A	G	19: 6,212,117		probably benign	Het
Mb21d1	G	A	9: 78,435,738		probably benign	Het
Mctp1	A	G	13: 77,020,821	I846V	probably benign	Het
Mrgpra2b	T	A	7: 47,464,127	I286F	possibly damaging	Het
Neil3	T	G	8: 53,609,396		probably benign	Het
Nox3	G	T	17: 3,695,563	N23K	probably damaging	Het
Nt5c3	T	C	6: 56,883,812	K219E	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr213	A	T	6: 116,540,485	N11Y	probably damaging	Het
Olfr389	T	A	11: 73,776,437	M297L	probably benign	Het
Olfr524	A	C	7: 140,202,116	F218C	possibly damaging	Het
Olfr548-ps1	T	A	7: 102,542,686	I250N	probably damaging	Het
Olfr954	T	C	9: 39,461,593	L54P	probably damaging	Het
Pacsin2	A	G	15: 83,379,795	V347A	possibly damaging	Het
Pcdhb7	A	T	18: 37,342,804	E331V	probably damaging	Het
Pcid2	A	C	8: 13,081,262		probably null	Het
Pcsk9	T	C	4: 106,450,077	D323G	possibly damaging	Het
Pdhb	T	C	14: 8,169,801	E203G	probably damaging	Het
Phlpp2	A	G	8: 109,928,463	Y630C	probably benign	Het
Pidd1	C	T	7: 141,439,133	A812T	probably damaging	Het
Plau	G	A	14: 20,842,314	R389H	probably benign	Het
Plekhg6	G	A	6: 125,364,629		probably null	Het
Ppox	T	C	1: 171,277,749	Y321C	probably damaging	Het
Pxdn	A	G	12: 29,987,066	N281S	possibly damaging	Het
Pycrl	A	T	15: 75,918,388	M138K	probably benign	Het
Radil	T	C	5: 142,497,873	Y526C	probably damaging	Het
Ranbp3	C	A	17: 56,707,169	D233E	probably benign	Het
Rhpn1	A	G	15: 75,711,872	Q402R	possibly damaging	Het
Sec23b	T	A	2: 144,568,612		probably benign	Het
Sel1l2	A	T	2: 140,240,912	L602*	probably null	Het
Sema5b	G	A	16: 35,646,355	G209D	probably damaging	Het
Svep1	T	C	4: 58,073,333	Y1992C	possibly damaging	Het
Syncrip	T	A	9: 88,456,259		probably benign	Het
Synj1	G	T	16: 90,967,354	A65E	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tecrl	T	C	5: 83,354,763		probably benign	Het
Tenm4	G	T	7: 96,777,851	G698C	probably damaging	Het
Tmem209	G	A	6: 30,491,182	L259F	probably damaging	Het
Tmem247	G	A	17: 86,918,503	E124K	possibly damaging	Het
Tnks2	C	A	19: 36,852,821	A218E	probably damaging	Het
Tppp	T	A	13: 74,021,311	F57I	probably damaging	Het
Trim36	A	G	18: 46,172,525	W452R	probably damaging	Het
Vars2	A	T	17: 35,664,584	V262E	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zfp516	G	T	18: 82,955,772	A32S	probably benign	Het
Zfy2	G	T	Y: 2,107,348	L429I	possibly damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
R9736:Atp10a	UTSW	7	58824330	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCCCTGCAACTACAGAATTGG -3'
(R):5'- GGAGCCTACAGAGCAATTATGCTGG -3'

Sequencing Primer
(F):5'- CAGAATTGGCACTTTCTGTAGTC -3'
(R):5'- GCTGGATTTCAGCTCTCTAAGAAC -3'

Posted On

2013-05-23