Incidental Mutation 'R4696:Zfp467'
ID386453
Institutional Source Beutler Lab
Gene Symbol Zfp467
Ensembl Gene ENSMUSG00000068551
Gene Namezinc finger protein 467
SynonymsEZI, MNCb-3350, 1190001I08Rik
MMRRC Submission 041946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48427697-48445825 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 48439357 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101443] [ENSMUST00000114556] [ENSMUST00000114558] [ENSMUST00000114559] [ENSMUST00000114560] [ENSMUST00000114561] [ENSMUST00000114563] [ENSMUST00000114564] [ENSMUST00000114566] [ENSMUST00000141449]
Predicted Effect probably benign
Transcript: ENSMUST00000101443
Predicted Effect unknown
Transcript: ENSMUST00000114556
AA Change: V69A
Predicted Effect unknown
Transcript: ENSMUST00000114558
AA Change: V88A
Predicted Effect unknown
Transcript: ENSMUST00000114559
AA Change: V88A
Predicted Effect silent
Transcript: ENSMUST00000114560
SMART Domains Protein: ENSMUSP00000110207
Gene: ENSMUSG00000068551

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114561
SMART Domains Protein: ENSMUSP00000110208
Gene: ENSMUSG00000068551

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114563
Predicted Effect probably benign
Transcript: ENSMUST00000114564
Predicted Effect probably benign
Transcript: ENSMUST00000114566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140198
Predicted Effect probably benign
Transcript: ENSMUST00000141449
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein whose function has not yet been elucidated in humans. However, the mouse ortholog of this protein enhances adipocyte differentiation and suppresses osteoblast differentiation in bone marrow. The mouse protein also is a transcription factor for several genes and can help recruit histone deacetylase complexes. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Zfp467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Zfp467 UTSW 6 48438681 missense probably benign 0.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R1509:Zfp467 UTSW 6 48438687 missense possibly damaging 0.95
R1517:Zfp467 UTSW 6 48438236 missense probably damaging 1.00
R1656:Zfp467 UTSW 6 48439079 missense possibly damaging 0.87
R2131:Zfp467 UTSW 6 48442661 missense probably damaging 0.98
R2912:Zfp467 UTSW 6 48439076 missense possibly damaging 0.95
R4714:Zfp467 UTSW 6 48427817 missense unknown
R4993:Zfp467 UTSW 6 48439029 missense probably damaging 1.00
R7038:Zfp467 UTSW 6 48438138 missense probably damaging 1.00
R7224:Zfp467 UTSW 6 48444969 critical splice donor site probably null
R7855:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
R7938:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGCATATGAGCACGCTG -3'
(R):5'- TGAGTCTACTGGCAAATGGATGTAC -3'

Sequencing Primer
(F):5'- TGCAACCTCTGGTGGAGC -3'
(R):5'- CTACTGGCAAATGGATGTACCCATG -3'
Posted On2016-06-03