Mutagenetix > Incidental Mutations

Incidental Mutation 'R4689:Rgs11'

386458

Institutional Source

Beutler Lab

Gene Symbol

Rgs11

Ensembl Gene

ENSMUSG00000024186

Gene Name

regulator of G-protein signaling 11

Synonyms

MMRRC Submission

041940-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R4689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26202951-26211324 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 26204547 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000025020] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000122058] [ENSMUST00000176961]

Predicted Effect

probably benign
Transcript: ENSMUST00000025019

SMART Domains

Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

Domain	Start	End	E-Value	Type
low complexity region	6	28	N/A	INTRINSIC
Pfam:Rho_GDI	29	222	1.2e-60	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000025020

SMART Domains

Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	34	109	7.78e-17	SMART
G_gamma	220	284	1.38e-19	SMART
GGL	223	284	1.1e-26	SMART
RGS	303	418	6.23e-47	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000025020

SMART Domains

Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	34	109	7.78e-17	SMART
G_gamma	220	284	1.38e-19	SMART
GGL	223	284	1.1e-26	SMART
RGS	303	418	6.23e-47	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121959

SMART Domains

Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

Domain	Start	End	E-Value	Type
Pfam:Rho_GDI	14	197	6.4e-65	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000122058

SMART Domains

Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	32	107	7.78e-17	SMART
G_gamma	218	282	1.38e-19	SMART
GGL	221	282	1.1e-26	SMART
RGS	301	416	6.23e-47	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000122058

SMART Domains

Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	32	107	7.78e-17	SMART
G_gamma	218	282	1.38e-19	SMART
GGL	221	282	1.1e-26	SMART
RGS	301	416	6.23e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123670

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139639

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176847

Predicted Effect

probably benign
Transcript: ENSMUST00000176961

SMART Domains

Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

Domain	Start	End	E-Value	Type
Pfam:Rho_GDI	14	222	1.9e-83	PFAM

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	C	A	17: 46,324,070	V336L	probably benign	Het
Acbd4	T	C	11: 103,105,368	L165P	possibly damaging	Het
Adam10	T	C	9: 70,765,954	S456P	possibly damaging	Het
Adgre4	T	C	17: 55,802,096	F368L	probably damaging	Het
Ahcyl1	G	T	3: 107,665,518	Y528*	probably null	Het
Aldh3b3	G	A	19: 3,964,516	V84M	probably damaging	Het
Cdca8	C	T	4: 124,931,103	G78E	probably damaging	Het
Cry2	T	C	2: 92,424,554	D152G	probably benign	Het
Cyp2c67	T	C	19: 39,638,588	Y266C	probably benign	Het
Dkk4	T	C	8: 22,625,320	F62S	probably benign	Het
Dnah12	G	A	14: 26,706,839	V207I	probably benign	Het
Dthd1	T	C	5: 62,842,912	C526R	probably damaging	Het
Dubr	A	T	16: 50,732,503		noncoding transcript	Het
F5	T	C	1: 164,151,973		probably benign	Het
Flcn	A	C	11: 59,801,044	W260G	possibly damaging	Het
Fmnl1	G	A	11: 103,193,736		probably null	Het
Frem2	A	T	3: 53,547,635	D2173E	probably benign	Het
Fstl4	C	T	11: 53,068,650	Q173*	probably null	Het
Gfra3	G	A	18: 34,690,587	P381S	unknown	Het
Gm28308	C	A	6: 52,213,311		probably benign	Het
Gm8394	T	A	10: 85,314,201		noncoding transcript	Het
Gm8730	T	A	8: 102,865,747		noncoding transcript	Het
Gzmd	T	C	14: 56,131,226		probably null	Het
Hexb	A	G	13: 97,181,092	Y366H	probably damaging	Het
Hydin	A	T	8: 110,595,414	H4566L	probably benign	Het
Ifi213	G	A	1: 173,590,420	T142I	possibly damaging	Het
Kif13b	T	A	14: 64,773,064	C1271S	probably damaging	Het
Krtap9-5	G	T	11: 99,949,460	C329F	unknown	Het
Larp1	G	T	11: 58,041,613	G207W	probably damaging	Het
Lfng	A	G	5: 140,614,439	D368G	probably damaging	Het
Mbd5	G	A	2: 49,258,279	V834I	possibly damaging	Het
Mterf1b	T	A	5: 4,197,263	Y301*	probably null	Het
Myh7b	T	C	2: 155,630,514	I1305T	possibly damaging	Het
Myo16	T	C	8: 10,438,890	V687A	probably damaging	Het
Naip2	A	T	13: 100,148,812	I1292N	probably damaging	Het
Nmral1	A	G	16: 4,714,558	F130L	probably damaging	Het
Nos1	A	G	5: 117,879,385	N271S	probably benign	Het
Nrap	A	G	19: 56,386,026	S23P	probably damaging	Het
Olfr106-ps	A	T	17: 37,394,771	N77I	probably damaging	Het
Olfr1509	T	C	14: 52,451,214	I267T	probably benign	Het
Olfr169	A	T	16: 19,566,513	Y123*	probably null	Het
Olfr800	T	C	10: 129,660,316	V170A	probably benign	Het
Pkdcc	C	G	17: 83,215,861	C132W	probably damaging	Het
Plekhg6	G	A	6: 125,373,181	L265F	probably benign	Het
Prkaa1	A	G	15: 5,178,696	T473A	probably benign	Het
Prpf3	G	A	3: 95,836,489	Q451*	probably null	Het
Ptprh	T	A	7: 4,597,997	D127V	possibly damaging	Het
Rab36	T	C	10: 75,041,933		probably null	Het
Rasa1	A	T	13: 85,238,163	Y427*	probably null	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Shank2	G	A	7: 144,420,605	V1087I	probably benign	Het
Slc39a10	A	C	1: 46,836,013	M43R	probably benign	Het
Slc40a1	T	A	1: 45,912,313	Q228L	probably benign	Het
Slc45a1	A	T	4: 150,638,539	L296Q	probably benign	Het
Stambpl1	A	G	19: 34,236,291	T307A	probably benign	Het
Stt3a	T	C	9: 36,732,929	T705A	possibly damaging	Het
Tec	G	A	5: 72,823,637		probably benign	Het
Trp63	A	T	16: 25,865,262	T300S	possibly damaging	Het
Vmn1r235	A	G	17: 21,262,361	H316R	probably benign	Het
Vmn2r1	A	G	3: 64,104,653	H645R	possibly damaging	Het
Wdfy4	A	G	14: 33,109,548	I907T	possibly damaging	Het
Zcchc10	A	G	11: 53,327,324	T33A	probably benign	Het
Zfp318	T	A	17: 46,399,634	V761D	probably damaging	Het
Zfp358	T	C	8: 3,496,146		probably null	Het
Zfp661	G	A	2: 127,577,548	P224L	probably damaging	Het
Zfp937	T	C	2: 150,236,786	M33T	probably damaging	Het
Zfp955a	T	C	17: 33,242,066	H364R	probably damaging	Het

Other mutations in Rgs11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Rgs11	APN	17	26207397	missense	probably damaging	1.00
IGL01617:Rgs11	APN	17	26208250	missense	probably damaging	1.00
IGL02150:Rgs11	APN	17	26202994	missense	probably benign	0.05
IGL02610:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02612:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02617:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02669:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02670:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02674:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02706:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02707:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02741:Rgs11	APN	17	26207631	missense	probably benign	0.31
R0147:Rgs11	UTSW	17	26207459	critical splice donor site	probably null
R0148:Rgs11	UTSW	17	26207459	critical splice donor site	probably null
R0508:Rgs11	UTSW	17	26207469	splice site	probably benign
R0744:Rgs11	UTSW	17	26203318	missense	probably damaging	1.00
R1479:Rgs11	UTSW	17	26208283	unclassified	probably null
R1599:Rgs11	UTSW	17	26208249	missense	probably damaging	1.00
R1779:Rgs11	UTSW	17	26210666	missense	probably damaging	1.00
R3692:Rgs11	UTSW	17	26204328	unclassified	probably benign
R3807:Rgs11	UTSW	17	26203500	missense	probably damaging	0.99
R3889:Rgs11	UTSW	17	26207587	missense	probably damaging	0.98
R4832:Rgs11	UTSW	17	26207568	missense	probably benign	0.00
R5052:Rgs11	UTSW	17	26207973	intron	probably benign
R5330:Rgs11	UTSW	17	26202973	start codon destroyed	probably benign	0.01
R5331:Rgs11	UTSW	17	26202973	start codon destroyed	probably benign	0.01
R5683:Rgs11	UTSW	17	26205181	missense	probably benign	0.32
R5879:Rgs11	UTSW	17	26203463	unclassified	probably benign
R6156:Rgs11	UTSW	17	26210465	nonsense	probably null
R6671:Rgs11	UTSW	17	26208298	missense	probably damaging	1.00
R7432:Rgs11	UTSW	17	26207760	missense	probably damaging	0.99
R7609:Rgs11	UTSW	17	26207441	missense	probably damaging	1.00
R7795:Rgs11	UTSW	17	26207578	missense	possibly damaging	0.88
R7820:Rgs11	UTSW	17	26205195	splice site	probably null
R8025:Rgs11	UTSW	17	26204385	critical splice donor site	probably null
Z1088:Rgs11	UTSW	17	26205772	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACACAAGACACCCTACTTTTGG -3'
(R):5'- TTGGGCTTAAACAGAGGCTGC -3'

Sequencing Primer
(F):5'- TTGGACAAGCACTATGTGGCC -3'
(R):5'- GAGGCTGCCTCCCCTTCTG -3'

Posted On

2016-06-03