Incidental Mutation 'R0426:Anapc15'
ID38647
Institutional Source Beutler Lab
Gene Symbol Anapc15
Ensembl Gene ENSMUSG00000030649
Gene Nameanaphase prompoting complex C subunit 15
Synonyms
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101863715-101901849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101898033 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000095839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000106973] [ENSMUST00000106978] [ENSMUST00000143835] [ENSMUST00000144207] [ENSMUST00000178851] [ENSMUST00000209334] [ENSMUST00000210984]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably benign
Transcript: ENSMUST00000035395
AA Change: T48A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649
AA Change: T48A

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098237
AA Change: T39A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649
AA Change: T39A

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106969
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106970
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106973
AA Change: T28A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649
AA Change: T28A

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106978
AA Change: T39A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649
AA Change: T39A

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect probably benign
Transcript: ENSMUST00000143835
AA Change: T39A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649
AA Change: T39A

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144207
AA Change: T39A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649
AA Change: T39A

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably benign
Transcript: ENSMUST00000178851
AA Change: T39A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649
AA Change: T39A

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000210984
AA Change: T39A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Anapc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0513:Anapc15 UTSW 7 101898540 splice site probably benign
R4625:Anapc15 UTSW 7 101901032 unclassified probably benign
R4846:Anapc15 UTSW 7 101897767 missense probably benign 0.05
R5318:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5334:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5337:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5396:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5398:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5399:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5427:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R7719:Anapc15 UTSW 7 101901029 missense unknown
R7903:Anapc15 UTSW 7 101897986 missense probably benign 0.07
R7986:Anapc15 UTSW 7 101897986 missense probably benign 0.07
Z1177:Anapc15 UTSW 7 101901039 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTTCATGTCCACACCATTTTGCAC -3'
(R):5'- TCAGCTTGACTATTCCCCACAGAGG -3'

Sequencing Primer
(F):5'- atggagccaggactcaaac -3'
(R):5'- GAGGAACCTTTTTCTAAGCAGGTC -3'
Posted On2013-05-23