Incidental Mutation 'R4728:Snrnp200'
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127227878 bp
Amino Acid Change Valine to Glutamic Acid at position 981 (V981E)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103220
AA Change: V981E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: V981E

low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140868
Meta Mutation Damage Score 0.8261 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R7924:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7946:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-06-03