Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Dlgap2'

386474

Institutional Source

Beutler Lab

Gene Symbol

Dlgap2

Ensembl Gene

ENSMUSG00000047495

Gene Name

DLG associated protein 2

Synonyms

PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2

MMRRC Submission

041974-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14095865-14847680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 14773380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 533 (Q533P)

Ref Sequence

ENSEMBL: ENSMUSP00000123104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]

AlphaFold

Q8BJ42

Predicted Effect

probably damaging
Transcript: ENSMUST00000043279
AA Change: Q533P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: Q533P

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129119

Predicted Effect

probably damaging
Transcript: ENSMUST00000133298
AA Change: Q533P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: Q533P

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141214

Predicted Effect

probably damaging
Transcript: ENSMUST00000150247
AA Change: Q533P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: Q533P

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1045	1e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152652
AA Change: Q534P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: Q534P

Domain	Start	End	E-Value	Type
low complexity region	270	295	N/A	INTRINSIC
low complexity region	298	311	N/A	INTRINSIC
low complexity region	447	457	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	615	629	N/A	INTRINSIC
Pfam:GKAP	715	1060	1.9e-160	PFAM

Meta Mutation Damage Score

0.2412

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Dlgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01476:Dlgap2	APN	8	14778301	nonsense	probably null
IGL01788:Dlgap2	APN	8	14843631	missense	probably benign	0.19
IGL02054:Dlgap2	APN	8	14843552	missense	probably damaging	0.98
IGL02969:Dlgap2	APN	8	14831579	missense	possibly damaging	0.95
IGL03183:Dlgap2	APN	8	14727525	missense	possibly damaging	0.62
IGL03303:Dlgap2	APN	8	14727812	missense	probably damaging	0.99
G1Funyon:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
PIT4403001:Dlgap2	UTSW	8	14831528	missense	probably damaging	1.00
R0026:Dlgap2	UTSW	8	14727363	nonsense	probably null
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0647:Dlgap2	UTSW	8	14727591	missense	possibly damaging	0.95
R1221:Dlgap2	UTSW	8	14726952	missense	probably benign	0.08
R1374:Dlgap2	UTSW	8	14831228	splice site	probably benign
R1440:Dlgap2	UTSW	8	14727060	missense	probably benign
R1544:Dlgap2	UTSW	8	14829861	splice site	probably null
R1550:Dlgap2	UTSW	8	14822499	missense	probably damaging	0.98
R1804:Dlgap2	UTSW	8	14727809	missense	possibly damaging	0.71
R1870:Dlgap2	UTSW	8	14773347	missense	probably damaging	1.00
R1921:Dlgap2	UTSW	8	14843624	missense	probably benign	0.10
R2119:Dlgap2	UTSW	8	14778206	missense	possibly damaging	0.69
R2193:Dlgap2	UTSW	8	14743431	missense	possibly damaging	0.51
R4381:Dlgap2	UTSW	8	14846502	missense	probably benign
R4422:Dlgap2	UTSW	8	14743463	critical splice donor site	probably null
R4521:Dlgap2	UTSW	8	14727871	missense	probably damaging	1.00
R4581:Dlgap2	UTSW	8	14846679	missense	probably damaging	1.00
R4585:Dlgap2	UTSW	8	14727999	critical splice donor site	probably null
R5077:Dlgap2	UTSW	8	14822691	missense	probably benign	0.35
R5373:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5374:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5552:Dlgap2	UTSW	8	14831342	nonsense	probably null
R5964:Dlgap2	UTSW	8	14727128	nonsense	probably null
R6125:Dlgap2	UTSW	8	14727193	missense	possibly damaging	0.78
R6147:Dlgap2	UTSW	8	14727294	missense	probably benign	0.05
R6163:Dlgap2	UTSW	8	14846641	missense	probably damaging	1.00
R6269:Dlgap2	UTSW	8	14822369	missense	probably benign	0.01
R6629:Dlgap2	UTSW	8	14831465	missense	probably benign	0.00
R6765:Dlgap2	UTSW	8	14743284	missense	probably benign	0.00
R6809:Dlgap2	UTSW	8	14179619	intron	probably benign
R6913:Dlgap2	UTSW	8	14778374	missense	probably benign	0.10
R7219:Dlgap2	UTSW	8	14743296	missense	probably benign	0.00
R7485:Dlgap2	UTSW	8	14829952	missense	probably damaging	0.97
R7560:Dlgap2	UTSW	8	14822697	critical splice donor site	probably null
R7826:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R7976:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R8101:Dlgap2	UTSW	8	14831600	missense	probably benign	0.04
R8301:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
R8333:Dlgap2	UTSW	8	14778295	missense	probably benign	0.03
R8367:Dlgap2	UTSW	8	14843544	missense	probably benign	0.00
R8492:Dlgap2	UTSW	8	14778271	missense	possibly damaging	0.49
R8685:Dlgap2	UTSW	8	14831628	missense	possibly damaging	0.71
R8690:Dlgap2	UTSW	8	14743430	missense	probably benign	0.00
R8887:Dlgap2	UTSW	8	14179682	critical splice donor site	probably null
R9328:Dlgap2	UTSW	8	14727441	missense	probably damaging	1.00
R9338:Dlgap2	UTSW	8	14179683	critical splice donor site	probably null
R9465:Dlgap2	UTSW	8	14778226	missense	probably damaging	1.00
R9680:Dlgap2	UTSW	8	14846653	missense	probably damaging	0.98
X0060:Dlgap2	UTSW	8	14839787	missense	probably damaging	1.00
Z1088:Dlgap2	UTSW	8	14822472	missense	probably benign	0.10
Z1177:Dlgap2	UTSW	8	14727659	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGCTCACAGACCACATTTC -3'
(R):5'- GACAATCACTAGGCCTTGGC -3'

Sequencing Primer
(F):5'- ACAGACCACATTTCTCTCTTCTCTG -3'
(R):5'- CAGCCTAAGCCGATGAGGTTTTG -3'

Posted On

2016-06-03