Incidental Mutation 'R4705:Papln'
ID386482
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Namepapilin, proteoglycan-like sulfated glycoprotein
SynonymsE030033C16Rik
MMRRC Submission 041953-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83763634-83792382 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 83777208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
Predicted Effect probably null
Transcript: ENSMUST00000021646
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121733
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152904
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4874:Papln UTSW 12 83777143 missense probably benign 0.01
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6861:Papln UTSW 12 83774949 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
R7850:Papln UTSW 12 83780662 missense probably damaging 1.00
R7977:Papln UTSW 12 83775382 missense probably damaging 1.00
R7987:Papln UTSW 12 83775382 missense probably damaging 1.00
R8321:Papln UTSW 12 83774941 nonsense probably null
R8324:Papln UTSW 12 83786619 missense probably damaging 1.00
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCAGTTACATGCGGGACTGG -3'
(R):5'- TGTTGCAGGCTTCCATCTCG -3'

Sequencing Primer
(F):5'- TGCGGGACTGGCATCAG -3'
(R):5'- TTGGACGACTGCAGGTCCAC -3'
Posted On2016-06-03